How Life Cycles and Genetics Helps Organisms Survive In a Complex World

The world is a very complicated place and it is changing all the time. It's got forests and mountains and streams and ponds and oceans and thunderstorms and winter and droughts and even ice ages and volcanoes. Fossils suggest that creatures have been living on this earth throughout three and a half billion years, generation after generation of creatures. And many of them have gone extinct but obviously not all of them because we are still here along with 2million other species of life.

How does life manage to adapt to all the environments of earth and all the changes that happen to these environments? By having all kinds of flexible life cycles and ways of inventing new traits! so lets learn about these.


LIFE CYCLES

A LIFE CYCLE is the sequence of stages from one newborn organism through it's development to an adult and then to reproduction to a new newborn offspring.. all the way back to the original form of the organism. Some life cycles are simple as in an amoeba growing bigger and then splitting in half to two smaller amoebas and then they grow bigger and split again to repeat the life cycle.

Or life cycles can be really complicated, like the fern life cycle. The adult fern sheds spores that don't grow into new ferns, instead they grow into tiny flat plants and then these plants grow sperms and eggs which mate and then grow into a new adult fern. This life cycle involves asexual reproduction, sexual reproduction which we will learn about soon.



DEVELOPMENT
In some life cycles the offspring are born like small versions of their parents and grow up directly to look like their parents. this is DIRECT DEVELOPMENT. Grasshoppers and amoebas do this.


In other life cycles the offspring are born as larva, that look different than their adult parents, and they grow bigger for a while. Then at some point they go through a process of METAMORPHOSIS and they change into the adult form of their parents. Frogs lay their eggs in ponds and the eggs hatch into tadpoles that can breath in water and eat algae. When the tadpoles get big enough they go through METAMORPHOSIS and sprout legs and grow lungs to breath air, and lose their tails and hop onto land. in the adult stage frogs eat insects and can even travel to new ponds.

Notice that metamorphosis allows a single species to live two totally different lifestyles in different environments. very clever!


TRAITS
From generation to generation the offspring will inherit TRAITS from their parents. INHERITED TRAITS come form the parents and happen because the offspring get their GENES from their parents. the GENES tell the offspring's bodies how to grow and behave. So you can inherit traits for eye color, hair curliness or even for certain inherited diseases. these are different than noninherited traits like being good at playing a musical instrument. for that trait you had to learn how to play and your ability to play didn't come from your parents. Another noninherited trait is height, if you eat healthier food than your parents did when they were growing up you might grow much taller than they did. In truth, it is often hard to tell whether a trait is inherited or not inherited or somewhere in between.


ASEXUAL REPRODUCTION
One part of an organism's life cycle is reproduction. The simplest kind of reproduction is ASEXUAL REPRODUCTION. the single celled amoeba life cycle is very simple. It eats, it grows, when it gets big enough it makes sure it has at least two copies of everything in its insides and then splits in half. each half is a nearly identical copy of the original amoeba, only half as big. The halves are often called daughter cells. Then they grow and repeat the cycle.

In asexual reproduction each daughter cell inherits its traits from the original amoeba. Two different amoebas from different parents might have different traits. The part of the cell that specifies what traits it will have are the CHROMOSOMES. The chromosomes are in the NUCLEUS. The GENES for all the traits are on the chromosomes. Some genes control one trait each, but usually many genes cooperate in complicated ways to control traits. The way the genes fit on the chromosomes took a lot of hard work to figure out and will be explained below in the section on meiosis.






In asexual reproduction each daughter cell has the same inherited traits as the parent because each got identical copies of the parent's chromosomes. when the parent cell was dividing it made exact copies of each of its chromosomes and then pulled each pair apart and positioned each copy in each half of the cell that would later split apart. This is called MITOSIS. In this way each daughter cell now has the same number of chromosomes than their parent.

Multicellular organisms can also reproduce asexually. Multicellular means that instead of being one cell like the amoeba, the organism is made of many cells stuck together. Most multicellular organisms like yourself, start out out as a single egg cell. That cell divides asexually using mitosis and now the two daughter cells are identical genetically. Except instead of crawling apart like the amoebas do, they stick together and then each divides and now there are 4 cells, and then they divide again and there are 8 cells, then 16 cells and so on until trillions of cells arrange themselves to make your body. (worm developing inside its egg on above). Since all these cells have to work together in the same body, it is good that they reproduce each other asexually so they all have the same inherited traits. This process of growing from one cell to an adult animal or plant is called DEVELOPMENT. (Plant embryo developing inside its seed on the left.)

Strawberry plants are multicellular organisms. A strawberry plant can grow out and bend back down and root itself in the ground and become a new plant. Since the offspring is made out of the original strawberry plant's body, all its cells have the same chromosomes as the parent and so it has all the same inherited traits as its parent does.


Another reason why some organisms reproduce asexually is that they live in an environment that does not change much. So their offspring might as well be identical to them. Here's an example:


Diatoms are single celled algae with finely sculpted shells, that look like little jewel boxes under the microscope. They live in puddles and ponds, streams and oceans. Let's talk about some living in a puddle. As long as the puddle is big enough they keep reproducing asexually so that one day there is one cell, then the next day 2, and the next day 4, and then 8 and 16, 32, 64.. how many will there be after two weeks? Since they reproduce asexually all the Diatoms will be identical and have the same inherited traits, which is good because they all live in the same puddle and so all need the same skills to survive. [scanning electron micrographs of marine diatoms at the right]

But what happens when the environment DOES change? What happens when the puddle starts to dry up? Then the offspring need to get to a new puddle or might even have to survive being dried out and wait for the next rain. If they have to go to a different puddle they might need different traits to survive in it. It might be deeper, or more sunny, or might have a different kind of mud in it, or it might even have creatures that eat Diatoms. So how will the Diatoms produce offspring that are different than themselves? This is what sexual reproduction is for.




SEXUAL REPRODUCTION
In SEXUAL REPRODUCTION, two cells with different traits come together, combine themselves into one big cell which will have different traits than either of its parents and then start growing again.

So some of the diatoms split up to become eggs and some of them split up many times to become tiny cells that grow swimming tails called FLAGELLA and become sperms. Sperm and eggs are called GAMETES. Eggs are big and stay in one place so that they can store all the food the new creature will need to start off its life and sperm are small and swim so that creatures can make a lot of them and they can spread out and find eggs from a different family (to find new different traits) to mate with.

So the sperm swims around looking for eggs from a different family and join with an egg to become one cell. Now it has different chromosomes than either of its parents Then it can grow into a hard round spore that can blow around in the wind and find a new puddle, or wait for the rain to make new puddles. When it reaches that puddle the living cell breaks out and begins the life cycle all over again beginning with asexual reproduction... And it might survive in that puddle because it has new traits that it's parents didn't have.

When diatom cells turn into sperm or into spores, it's a kind of metamorphosis!

[note: I'm actually mixing up details from a few different kinds of algae so that i can get it all in one story.]


CHROMOSOMES IN SEXUAL REPRODUCTION
Fine, cells split up during asexual reproduction, then they come back together in sexual reproduction, then they split up again... But wait! we forgot to keep track of the chromosomes, what are they doing?

If the Diatoms did this:
It would be good, the new offspring would have the traits of both parents, and they would be able to reproduce asexually in a new pond. The cell with two chromosomes can reproduce asexually into two identical cells.

But when it becomes time for sexual
reproduction again, look what happens: Some cells have one chromosom, some cells have two... Cells with one chromosome can join with cells with two chromosomes to make cells with three chromosomes. Two cells with two chromosomes each can join to make cells with four chromosomes... The Diatoms will end up with more and more chromosomes and each one will have a different number of them. This will totally botch up the cells! So sexual reproduction will have to work differently!

So after the sperm and egg join, the new diatom will have a chromosome from each parent, and then they can reproduce asexually, so far so good. When it comes time make sperm and eggs to come together in sexual reproduction, the cells could split the number of chromosomes in half, like this:

Then the cells with one chromosome each can join again in sexual reproduction and make cells with two chromosomes. This works pretty good, but in our diagram the new single chromosome cells are exactly the same as the original ones. So no new traits are invented. This isn't good either! So real cells do something even more complicated. It's called meiosis.


HOW MEIOSIS WORKS
So the actual way that cells reproduce sexually is as follows. I am going to show the genes on each chromosome so that we can follow them.

MAKING EGGS
Suppose our mother diatom has these two chromosomes, one from each of her parents. These are the different colored chromosomes in the diagram of the Diatom life cycle.

Each letter stands for a different gene. The genes are strung along the chromosome. Of course the chromosomes are really much longer than I've shown because each chromosome could have a thousand genes. Well i bet if you really think about your whole body with all its parts and all the things you can do like digesting eggs, and singing, and breathing and growing hair you will realize that you have 1000s of traits too!

Notice that the chromosomes are mostly the same with some differences. in the first position, each has the same gene A. in the second position each has a different gene B or b.

First the cell makes a copy of each chromosome as if it were going to do asexual reproduction. My drawings will get too crowded if i show all the copies, so i won't. Then it brings the two chromosomes (really 4) together and joins some of them at a few places (we show just one place):

Then parts of the chromosomes swivel around, trade places and the breaks rejoin. (in reality all 4 strands that i didn't draw can mix and match like this).This twisting and rejoining is called CROSSOVER.






Then the cell pulls one pair from the other pair (I've only shown one of each pair)










Then the cell does a mitosis step and splits the chromosomes into 2 cells (in reality there are 4 different chromosomes and the cell splits twice to put each chromosome in each cell). Each of these cells will become an egg.

MEIOSIS is this whole clever process of bringing the chromosome pairs together, mixing and matching them and pulling them apart into separate cells called GAMETES. Now each gamete has the same number of chromosomes as the original gametes in our pictures above and now sexual reproduction can work.

Notice that the chromosomes in each daughter cell is different than each of the chromosomes of the parent cell because of all that twisting.



MAKING SPERM
The male diatom will do the same thing, but to produce lots of swimming sperm first he will do many asexual reproduction steps to fill up his shell with lots of little cells. Then each of these will do meiosis steps, but each one will do the crossover at a different place in the chromosomes and each of the 100s of sperms will come out different.





FERTILIZATION
Finally the sperm swims around and finds an egg and they combine together into a new big cell called the zygote or fertilized egg. and that cell will again have a pair of each chromosome. Egg AbcDEFG combines with sperm abc'DEfG.










Finally we've got the whole sexual reproduction life cycle to work. Check out this diagram for the Diatom life cycle. click on it to make it larger.



MULTICELLULAR ORGANISMS
Multicelled organisms can also reproduce sexually by doing meiosis on some of their cells and forming single celled GAMETES, the females make eggs and the males make sperm. Then the gamete cells are the ones to join. When the sperm and egg join they become a fertilized egg or ZYGOTE. Then this single cell will develop into a multicelled organism as we've described way above by asexual reproduction with mitosis, and the cells sticking together. Click on the picture below to make it larger.


Notice that cells and organisms seem to go through these alternating cycles of sexual and asexual reproduction.



HOW TRAITS COMBINE: DOMINANT, RECESSIVE, INCOMPLETE DOMINANCE, EPISTASIS
Genes can combine in many ways to produce traits. First we will look at the way genes that are on the same position on the chromosome can combine.

1) DOMINANT TRAITS AND RECESSIVE TRAITS. Black color in cats (the C gene) is dominant over the Siamese color (the ch gene). That means that if a cat has only the genes C C it would be black. If the cat has only the genes ch ch, it would have Siamese coloring, but if the cat has both, C and ch, it will still be black. So we say that black color is the DOMINANT TRAIT and Siamese color is the RECESSIVE TRAIT.

This happens inside the cats cells because the C gene makes a chemical called Melanin which makes dark colors. The ch gene is defective and doesn't make melanin, so no color. If you have C and ch, the C still makes melanin. If you have ch and ch, there's no genes to make melanin.

Another way to think about this is if a siamese cat with the genes ch ch on both chromosomes has kittens with a black cat with the genes C C on both chromosomes. The kittens will be black and have the genes C ch because each gamete has only one chromosome, one gamete gets an C and the other gets an E, and then they join to start a kitten growing. The siamese color is recessive.

But RECESSIVE TRAITS are interesting. The kittens will grow up into adults black cats with C ch genes. If two black cats with C ch genes have kittens, remember that the father's C and ch genes get separated into two gametes, and the mother's C and ch genes get separated into two gametes and remember that the gametes can combine in all sorts of ways into a fertilized egg. So some of the kittens can have the ch ch genes and be siamese again. So if one parent has a recessive trait, the children won't show that trait, but grandchildren might!

2) INCOMPLETE DOMINANCE happens when neither trait is totally dominant over the other, something in between might happen. In Carnations, the trait for red flowers (R R) blends with trait for white flowers (r r) and you get a new color: pink (R r).

ENVIRONMENT CAN AFFECT TRAITS
One more thing to notice in our siamese cats. Their faces, ears, tails and paws are black! That's because the ch gene doesn't work where the body is warm, so no melanin is made, but it works where the body is cold at the extremities and it makes melanin there. So here is a case where the traits are not entirely specified by the genes! The different markings aren't inherited from the parents, but depend on how the cat grows and where it lives.


BACK TO OUR PUDDLE FULL OF DIATOMS
So, one sperm combined with one egg. Here's a picture of our Diatom family:

This offspring is totally different than its parents.

Mother: A, A, D, D, E, e, C, c
Father: a, a, d, D', E, e, C, c'

Offspring: A, a, D, D, E, E, c, c'

Suppose e is the gene for the trait of soft shells that cover the Diatoms and it's dominant over E, the trait for hard shells. Then each parent will have the dominant trait: soft shells. But the offsping has E E so it will have the hard shells, that's different than the parents.

C might be the gene for the trait for faster growing shells. It might be dominant over c and c'. So the parents have fast growing shells, but the offspring will have slower growing shells.

GENES ON DIFFERENT POSITIONS ON THE CHROMOSOMES CAN INTERACT ALSO.
Not only that but genes at two different positions, A and C might combine to make new totally unpredictable traits. Suppose A is the gene for smooth shells, and a is for rough shells. and A is dominant over a, so the mother has smooth and father has rough. The offspring would have smooth too (dominant) but, c' might interact with A to make spikes on the shells. Neither parent has these!

This is how sexual reproduction produces offspring with totally new traits. Parents producing gametes by meiosis and then different combinations of parents coming together produce new combinations of gens. New combinations of genes can have new unpredictable traits.


TO SUM UP.
Notice all the different forms that organisms can take: metamorphosis, eggs, sperm, spores, haploid, diploid. Notice all the different kinds of life cycles: asexual, sexual, alternation between asexual and sexual... And there are even dominant, recessive and incompletely dominant traits... All these combinations make organisms incredibly flexible and creative in their abilities to adapt to their changing environments!

Narration For DNA Wrapping and Copying Video

.
.
here is the video from youtube

here is the narration:

0:11 seconds
so here we have a double string of nucleotide beads that spirals around itself (called the DNA double helix) like an old fashioned telephone cord. this is floating around in the cell with a negative static electric charge on it.

0:24 seconds
now proteins called histones are bumping into it. they are positvely charged and shaped just right to stick to the DNA the right distance apart and they cause the spiral to wrap up into mini spirals that bunch up into this new strand like those lanyard thingies that you probably have made.

0:49 seconds
now the supersprial spirals again into a superduper spiral

1:05 seconds
now the superduperspiral coils up yet again into a superduperduper spiral

1:12 seconds
and that makes one of your chromosomes. you have have 48 chromosomes and

1:13 seconds
here we see a cell reproducing itself by spliting in half. while it does that it has to separate out two copies of each of these 46 superduperduper chromosome twists, one for each cell.

[now your dna needs to be wrapped up this many times because in every one of your cells, the dna is 3 feet long! yet it has to fit into a cell that's a 500th of an inch wide. that's 500 cells can line up in an inch. or about 300 cells can fit into a period. imagine packing 3 feet of superfine thread into something so tiny! plus you gotta keep it from getting tangled!]


1:50
before that can happen though the chromosomes have to uncoil all that stuff and get copied! now here is the gang of of CRAZY PROTEIN machines that gang up on the DNA strand and copy it.

the double strand to be copied comes in from the left.

remember i said the DNA is TWO strands wrapped around each other. the trouble is one gets read left to right and the other gets read right to left, (they are opposites of each other) so they have to get copied in OPPOSITE DIRECTIONS. but the whole copy operation only goes forward.

so the blue machine splits the strands and unravels them, the forward reading strand goes down and gets fed into the purple and green protein machines below that add on a new strand to it to make it double again. they add the new strand from LEFT TO RIGHT AWAY from the original double strand to be copied. that's one copied DNA double helix that goes to one of the daughter cells.

the other strand that reads backwards gets sent the right through the grey/purple protein machine ahead to the right, and it gets looped around to the back and goes up and away in the picture.

the first protein machine copies the forward reading strand from left to right below, but the second purple green protein machine must copy the backwards strand from right to left but that would crash into the blue machine, so that's why the strand loops backwards first. notice that the top machine is copying in the diraction TOWARDS the original double strand. (opposite direction of the bottom copying machine, follow the strands) but it has to stay some distance away so it doesn't crash into the blue machine. anyway this will become the other double strand that gests sent to the other daughter cell.

1:55
now before we met this crazy machine, the top machine had already copied some of the backwards strand further away down the strand so now the new copying operation is going to join with the second double strand that was copied some seconds ago:

1:55 a new green machine comes in from the right because ..

1:57
the old backwards strand green machine is separating from the copied strand and the join is complete. meanwhile a new green machine has come in along with the purple machine is proceeding to make a NEW LOOP to start the whole process over agaiin.

2:08 is the closeup. the forward reading strand is to the right and the backward reading strand is coming out the top and to the left is the green/puprle machine copying the other end of that loop.

i think they make the video go too fast!

fluffy milkweed pic came out nice through cell phone

here's a shot of milkweeds i took on a walk last weekend through a cellphone. i think it came out particularly well.

Supercolider Rap: Epic Poetry About Cern

Now i want someone to make one about the engineering and teamwork as opposed to the theoretical physics. that's what amazes me.

more


more



more details

A Quick Crazy Intro To Genes Chromosomes and DNA

first some fun movies:

chromosomes and dna:
http://www.youtube.com/watch?v=Pj9cdVeIntY

the rest of the city that a cell is:
http://www.youtube.com/watch?v=BVvvx5HGpLg



BODIES ARE BUILT OUT OF, AND BY, INTERACTING CELLS, JUST AS NATIONS ARE BUILT OUT OF, AND BY, INTERACTING CITIES

our bodies are confederations, societies, of living cells. Some cells can live independently. For instance, sperm cells can live for a few days if given the right nutrients and temperature, other cells for instance, single celled Amoebas, and Parameciums are entirely independent critters that can live all by themselves in ponds. But most of our cells are dependent on each other and stay together to make this society we call the human being.

Another important fact about cells is that cells give birth to other cells. There is no other way for living creatures to make cells from scratch. There are two ways that cells can give birth to new cells: asexual reproduction (mitosis) and sexual reproduction. In asexual reproduction the cell copies it's insides and splits into two genetically identical halves. now there are two living cells where there was once one.

In sexual reproduction, two different cells will come together, commingle their parts (genes and all) and then mix and match their genes and then separate into 4 DIFFERENT cells. The reason for 4 and the mechanics of this complicated process i will explain later.


You are a society of cells that started out as a single cell colonist inside your mom's body, one fertilized egg in her fallopian tube. This cell, this living creature, proceeded to reproduce asexually, just growing and then splitting in half and then the halves splitting in half and so on... they ate your mom's juices and held together and crawled all over each other till they built the society that was you.

How did they do it? how did they know to build you and not a starfish or elephant? It was in their genes. like this:


CELLS USE LIBRARIES, BLUEPRINTS, PROTEINS AND PROTEIN BUILDING FACTORIES TO BUILD THEMSELVES AND FUNCTION

When i said that you are a society of cells, i actually should have said that you are a nation of different cities! Each cell is as complicated as a whole city with all kinds of roads and buildings and machines and construction workers and decision makers... Each cell/city can come to specialize in certain crafts and trade with each other in this nation that is you. For instance red blood cells trade oxygen with the lungs and bring it to other parts of the body. intestine cells digest food from the stomach and trade it with liver cells in return for processing of the food. And on and on. Our bodies have over 250 different kinds of cells all working together to make us.

Each cell has a library of genes from which it copies blueprints to send out to construction sites in the cell to do all of it's construction. the library of genes also has bulletin boards for posting notes on the current stages of construction so the thing can be coordinated.

the library is in the form of 48 separate chromosomes. each chromosome is a superduperduperdupercoiled strand of DNA double helix with some complications (watch the movie of how a strand of dna twists into a chromosome!) Think of the old fashioned telephone cords. they are a little wider than thick in cross section, almost like a ribbon, and coiled like a helix spiralled around itself. Most of the time it gets even more twisted and supercoils around itself! The DNA strand is shaped like the phone cord, wider than thick because it's actually two strands parallel to each other.

each string is actually a string of beads of 4 types. 4 different kinds of Nucleotides. A, C, G or T. so one string looks like AACCGTCCCTAG... the other string will look like TTGGCAGGGATC... They match up; the As connecting to the Ts and the Cs connecting to the Gs to make a kind of ribbon:

AT
AT
CG
CG
GC
TA
CG
CG
CG
AT
GC
..
..
..

and that ribbon, twists around to make the double helix.


A sequence of these 4 types of nucleotides spells out in a kind of Morse code, one specifying the sequence of amino acids to string together and make a protein. A different sequence of amino acids makes a different protein. So a different sequence of nucleotides makes a different protein. This sequence of nucleotides is what is called a gene. There are many gene sequences strung out one after another on each of these chromosomes.

but each chromosome is a ribbon made of two different strings of nucleotide beads. The blueprints that are sent to the protein making factories are called messenger RNA. RNA is like DNA; it's also made of strings of nucleotides. But the RNA strings don't form DOUBLE helices, only single strings. Just as the two DNA strands compliment each other A for T and C for G, the RNA copy will compliment ONLY one of the DNA strands with a minor hitch: A for T and U for C, no G.

so from a chromosome that looks like this:

AACCGTCCCTAG...
TTGGCAGGGATC...

The cell will copy off an RNA blueprint like this from the top strand: TTUUCAUUUATC.

are there TWO different codes on each double helix then? Are there different genes on each strand of the double helix? This is a good question. Notice that the two strands compliment each other every where on one strand where there is a T the other strand has an A, etc.. So the two strands don't really say anything DIFFERENT, if you know the sequence from one strand you can figure out the sequence opposite it on the other strand.

In certain viruses, the answer to your question is YES, you can get different genes on each strand, like this:

AACCGTCCCTAG...
TTGGCAGGGATC...

one gene might start with the second A at the top and read ACCGTCCCTAG, and another gene might start at the bottom with the last C and run backwards (for reasons of the mechanics of the dna..) CTAGGGACGGTT...

For humans, i don't know the answer. I'll have to get back to you on that.


The proteins are also like strings of beeds. More like chains. Chains of different amino acids. There are 22 different kinds of amino acids, each a different shape, each having a different kind of stickiness to the other amino acids in the chain and to the water which bathes everything in a cell. these chains also twist and coil, depending on how the different amino acids stick to each other and interact with the water and the protein folds up into complicated shapes that either become certain building blocks, or even little dynamic machines!



When a blueprint of a gene sequence is copied and sent to a protein factory called a ribosome, the workers (called transfer RNA) read the sequence off 3 nucleotides at a time: AAC CGT CCC TAG... For each triplet they add another amino acid to the growing chain to make a protein. Which amino acid depends on the triplet pattern: AAC might mean leucine, CGT might mean methionine, etc...

Proteins are made of from a few hundred to a few thousand amino acids, so genes are from many hundreds to many thousands of nucleotides long. 30,000 genes on 48 chromosomes...


The next question is where do the genes start. Well there are special codes for starting and stopping points. AAA is start, TTT is stop [fix this]

so this strand:
CTACCCAAAACTAGGCGGTTTGTAACTAAACCCGCTACCTTATTTGGG

will have two genes: one starting AAA ACT AGG CGG TTT and another one starting AAA CCC GCT ACT TTA TTT. note there is other stuff between the genes (of course this example is abbreviated so i don't show the 100s of nucleotides for each gene). In fact, the situation is a LOT more complicated then this! (and you thought this was already complicated!)


There are 22 different kinds of amino acids and they behave very differently. different strings of amino acid beads twist into different shapes and the amino acids interact in different ways to make each protein a very different structure. some bind together into fibers, others make doorways in the cell, others catalyze chemical reactions and others can walk along fibers and carry things around the cell.

the sequence code also tells the blueprint copiers when to start copying and when to stop and also specifies places to post bulletins about whether and when the sequence ahead or behind should be copied and how much it is currently being copied and all sorts of other things. Things like, if the cell next door sends a message to you telling you he is next to you, that message will be posted on this bullet en board somewhere... and it will effect the blueprint copiers and change which blueprints to copy at the moment.

the whole thing could get rather bewildering and we don't know all the complications yet.

a gene used to be what we called one sequence that stands for one blueprint to build ONE protein. but now we know it is a little messier, sometimes we call the regions that specify where to post bulletins part of the gene. Sometimes the blueprint copy gets cut up and rearranged in different ways to make different kinds of proteins from the same gene. the same kinds of signals that influence what's on the bulletin boards also influence how a blueprint is spliced up to make different genes.

anyway this complicated rigmarole actually works and helps cells coordinate their behavior and makes them distinct from cells of other creatures. each kind of critter has a distinct set of blueprints to direct it's activities and structures.


actually those 46 chromosomes are actually 2 pairs of 23. one set from each parent! hah! you actually contain two different libraries in you at the same time. they are pretty similar and USUALLY coordinate pretty well, in fact gives you some flexibility. if parents who are too different try to mate, say horses and donkeys, their child will be a mule, mostly works but when THEY try to breed they find that the libraries are too different, confusion sets in and breeding doesn't work. If the parents are WAY different, say, a horse and a deer, the libraries will contain such conflicting information that the cell containing them won't even be able to function very far and make a baby.



HOW THE SAME CHROMOSOME LIBRARY IN EACH CELL OF A CRITTER TELLS EACH CELL HOW TO BE DIFFERENT TO MAKE THE DIFFERENT ORGANS OF THE CRITTER.

back to your initial cell. when it splits into two 'daughter cells' each has MOSTLY the same components of the original cell, but they copy the whole set of 46 strands of chromosomes into two IDENTICAL copies one per each cell. These two daughters also split into two daughters each, and so on... Eventually the100billion cells in your body have (MOSTLY, the differences are in the genes for the immune system, another fascinating topic!) the same sets of 46 chromosome libraries. each cell has identical genetic information.

how then does each organ come out different? Two causes. The original eggcell actually is NOT symmetrical! When it splits into two daughters, then 4 etc... even though each daughter cell has IDENTICAL chromosome libraries, each daughter cell will differ in other cell components, various small molecules because the original egg had some components in one side different components on the other side, etc..

Now the bulletin board parts of the libraries come into play. If cell A has more molecule a than b in it, then molecule a will stick to its bulletin board and turn on gene C. If cell B has more molecule b than a in it, then molecule b will stick on that bulletin board and turn OFF gene C

Now the two cells will start functioning differently... They will have daughter cells each with identical genes from their mother cells, and having mostly the same small molecules but some different bulletin board posts from their mother cells...

eventually, each cell is surrounded by different kinds of cells. now cell - cell signalling comes into play. cells will also send signals to their neighbors that get posted on various chromosome bulletin boards. and in this way, each cell's neighbors effect what genes that cell will be copying and using and thus cells neighboring cells will cause each other to change even more... eventually you get an embryo growing with all kinds of different cells. Then the different kinds of cells can tell where they are in the body, because their neighbors signal to them and thus they can form the different organs..

It was important all the while, even though many different kinds of cells are forming, that the libraries are all identical. because eventually some of these different kinds of cells, must become new eggs and sperms, and they have to have the identical libraries in them from the parents. If the libraries, the genes themselves were all scrambled up and scribbled on with all the bulletins, the children that come from the next generation of eggs would be WAY TOO different from their parents and wouldn't make a very viable critter.

so to make a new egg, all the bulletins have to be cleared off the chromosomes? ah... that's a subtle question!


These different when a cell finds itself in a different positions with different neighbors in your growing embryo, it begins to post different BULLETINS on the dna next to the appropriate genes telling the other machinery in the cell whether to use those particular blueprints or not. eventually the different cells come to have different looking bulletin boards specifying different parts of the library that are to be read. same library in each cell, just different cells read different books in it according to their task.

Where Does the Wealth Of Variety In Chemistry Come From? Math!

Physical properties of substances have to do with the relocation of electrons. Of stacking electron orbitals.

So...

neon starts of with 8 electrons and none in the outer shell. neon is a quiet inert atom. it doesn't engage in much chemistry. Add one electron to that outer shell however and you get sodium a highly reactive metal that wants to give up that lone electron. So Sodium cations swim in a sea of shiny malleable wandering valence electrons.

Add yet another electron to the mix and we have 2 electrons in the outer shell. anothe slightly less reactive metal, magnesium. Add another electron to the outer shell and now we have a total new orbital and we get aluminum, less reactive and the transition from MgO a soluble opaqe soft crystal to Al2O3 a nonsoluble transparent very hard crystal: ruby.

Add yet another electron and we get another orbital, silicon. A softer metal again but it's oxide SiO4 now can form dozens of varieties of chains and rings and matrixes which give us our vast variety of minerals on Earth: quartz, feldspar, mica..

Add yet another electron and we get a third orbital, phosphorus, a very reactive P4, nonmetalic spongy stuff, and PO4 cannot form stable chains at all, no vast variety of minerals, it forms instead, an acid.

Add another electron, no new orbital, start filling in the old ones and we get Sulfur, S8 a harder nonreactive solid, and S02 is now a gas. Add another electron and we get chlorine, Cl2 a highly reactive gas, and ClO is i don't know what.

Add another electron and all the orbitals are full again and once again we have argon, an inert element who engages in no chemistry at all.


To what do we owe this INTERESTING wealth of variety? The variety of chemistry is fascinating yet not totally chaotic. It all comes eventually from mathematics, Which is one of the recurring themes of complexity lab.

The relationships between these electron orbitals are determined by their energy level, their arrangement in space. Which are ultimately determined by the properties of solutions to a complex set of shrodinger's partial differential equations. Solutions that make different structures in 3 dimensional space. It would take us too far afield to explain these solutions (a few years of calcullus actually...), so we will present a simpler example: numbers.


What could be simpler than the numbers: 1, 2, 3, 4...

Lets see what happens to them every time we add one to the previous number to get the next. Just like we added one electron at a time to our elements.

1 is a unique number. 2 is the first prime number and peculiar because it is even. 3 is the first odd prime number. 4 all of a sudden is composite 2X2. 5 is prime again. 6 is now composite with TWO DIFFERENT factors 2X3. 7 is prime again. 8 is very composite 2X2X2 if we like we can consider it 3 dimensional. The next number? a prime again? NO, it's composite also; 9; 3X3. The next is composite also 10; 2X5. 8 seems to stand out as a lonely 3 dimensional number here. 11 is prime. 12 is the first example of a number with 2 different factorizations 2X6 or 3X4. Or you can call it also, 3 dimensional 2X2X3. 13 is prime again.

You get the drift. by simply adding 1 to the number we change the MULTIPLICITIVE (or geometric) properties of the numbers in unpredictable interesting ways. This is one of the simplest examples of how mathematics can give us the spice of life, the variety in the world that we see around us.

References on Newton and God

a general introduction can be found in Edward B. Davis' chapter in the recent book:


Galileo Goes to Jail and Other Myths about Science and Religion
by Ronald L. Numbers

In it he states that Newton was not a deist but believed it was blasphemy to think that God did not constantly interact with his creation. He bases this on some letters between his associate Samuel Clarke, and Leibniz

H. G. Alexander "the Leibniz - Clarke correspondence" Manchester U. pr. 1956 pg 11-12, 14

more info maybe here also:

"God of Gods, and Lord of Lords: the theology of Isaac Newton's General Scholium to the principia" Stephen D. Snobelen, Osiris #16 (2001) pgs 169-208


hmm apparently Newton was a very complicated fellow. here is a bbc presentation on his life