Wednesday, July 29, 2009

A Quick Crazy Intro To Genes Chromosomes and DNA

first some fun movies:

chromosomes and dna:
http://www.youtube.com/watch?v=Pj9cdVeIntY

the rest of the city that a cell is:
http://www.youtube.com/watch?v=BVvvx5HGpLg



BODIES ARE BUILT OUT OF, AND BY, INTERACTING CELLS, JUST AS NATIONS ARE BUILT OUT OF, AND BY, INTERACTING CITIES

our bodies are confederations, societies, of living cells. Some cells can live independently. For instance, sperm cells can live for a few days if given the right nutrients and temperature, other cells for instance, single celled Amoebas, and Parameciums are entirely independent critters that can live all by themselves in ponds. But most of our cells are dependent on each other and stay together to make this society we call the human being.

Another important fact about cells is that cells give birth to other cells. There is no other way for living creatures to make cells from scratch. There are two ways that cells can give birth to new cells: asexual reproduction (mitosis) and sexual reproduction. In asexual reproduction the cell copies it's insides and splits into two genetically identical halves. now there are two living cells where there was once one.

In sexual reproduction, two different cells will come together, commingle their parts (genes and all) and then mix and match their genes and then separate into 4 DIFFERENT cells. The reason for 4 and the mechanics of this complicated process i will explain later.


You are a society of cells that started out as a single cell colonist inside your mom's body, one fertilized egg in her fallopian tube. This cell, this living creature, proceeded to reproduce asexually, just growing and then splitting in half and then the halves splitting in half and so on... they ate your mom's juices and held together and crawled all over each other till they built the society that was you.

How did they do it? how did they know to build you and not a starfish or elephant? It was in their genes. like this:


CELLS USE LIBRARIES, BLUEPRINTS, PROTEINS AND PROTEIN BUILDING FACTORIES TO BUILD THEMSELVES AND FUNCTION

When i said that you are a society of cells, i actually should have said that you are a nation of different cities! Each cell is as complicated as a whole city with all kinds of roads and buildings and machines and construction workers and decision makers... Each cell/city can come to specialize in certain crafts and trade with each other in this nation that is you. For instance red blood cells trade oxygen with the lungs and bring it to other parts of the body. intestine cells digest food from the stomach and trade it with liver cells in return for processing of the food. And on and on. Our bodies have over 250 different kinds of cells all working together to make us.

Each cell has a library of genes from which it copies blueprints to send out to construction sites in the cell to do all of it's construction. the library of genes also has bulletin boards for posting notes on the current stages of construction so the thing can be coordinated.

the library is in the form of 48 separate chromosomes. each chromosome is a superduperduperdupercoiled strand of DNA double helix with some complications (watch the movie of how a strand of dna twists into a chromosome!) Think of the old fashioned telephone cords. they are a little wider than thick in cross section, almost like a ribbon, and coiled like a helix spiralled around itself. Most of the time it gets even more twisted and supercoils around itself! The DNA strand is shaped like the phone cord, wider than thick because it's actually two strands parallel to each other.

each string is actually a string of beads of 4 types. 4 different kinds of Nucleotides. A, C, G or T. so one string looks like AACCGTCCCTAG... the other string will look like TTGGCAGGGATC... They match up; the As connecting to the Ts and the Cs connecting to the Gs to make a kind of ribbon:

AT
AT
CG
CG
GC
TA
CG
CG
CG
AT
GC
..
..
..

and that ribbon, twists around to make the double helix.


A sequence of these 4 types of nucleotides spells out in a kind of Morse code, one specifying the sequence of amino acids to string together and make a protein. A different sequence of amino acids makes a different protein. So a different sequence of nucleotides makes a different protein. This sequence of nucleotides is what is called a gene. There are many gene sequences strung out one after another on each of these chromosomes.

but each chromosome is a ribbon made of two different strings of nucleotide beads. The blueprints that are sent to the protein making factories are called messenger RNA. RNA is like DNA; it's also made of strings of nucleotides. But the RNA strings don't form DOUBLE helices, only single strings. Just as the two DNA strands compliment each other A for T and C for G, the RNA copy will compliment ONLY one of the DNA strands with a minor hitch: A for T and U for C, no G.

so from a chromosome that looks like this:

AACCGTCCCTAG...
TTGGCAGGGATC...

The cell will copy off an RNA blueprint like this from the top strand: TTUUCAUUUATC.

are there TWO different codes on each double helix then? Are there different genes on each strand of the double helix? This is a good question. Notice that the two strands compliment each other every where on one strand where there is a T the other strand has an A, etc.. So the two strands don't really say anything DIFFERENT, if you know the sequence from one strand you can figure out the sequence opposite it on the other strand.

In certain viruses, the answer to your question is YES, you can get different genes on each strand, like this:

AACCGTCCCTAG...
TTGGCAGGGATC...

one gene might start with the second A at the top and read ACCGTCCCTAG, and another gene might start at the bottom with the last C and run backwards (for reasons of the mechanics of the dna..) CTAGGGACGGTT...

For humans, i don't know the answer. I'll have to get back to you on that.


The proteins are also like strings of beeds. More like chains. Chains of different amino acids. There are 22 different kinds of amino acids, each a different shape, each having a different kind of stickiness to the other amino acids in the chain and to the water which bathes everything in a cell. these chains also twist and coil, depending on how the different amino acids stick to each other and interact with the water and the protein folds up into complicated shapes that either become certain building blocks, or even little dynamic machines!



When a blueprint of a gene sequence is copied and sent to a protein factory called a ribosome, the workers (called transfer RNA) read the sequence off 3 nucleotides at a time: AAC CGT CCC TAG... For each triplet they add another amino acid to the growing chain to make a protein. Which amino acid depends on the triplet pattern: AAC might mean leucine, CGT might mean methionine, etc...

Proteins are made of from a few hundred to a few thousand amino acids, so genes are from many hundreds to many thousands of nucleotides long. 30,000 genes on 48 chromosomes...


The next question is where do the genes start. Well there are special codes for starting and stopping points. AAA is start, TTT is stop [fix this]

so this strand:
CTACCCAAAACTAGGCGGTTTGTAACTAAACCCGCTACCTTATTTGGG

will have two genes: one starting AAA ACT AGG CGG TTT and another one starting AAA CCC GCT ACT TTA TTT. note there is other stuff between the genes (of course this example is abbreviated so i don't show the 100s of nucleotides for each gene). In fact, the situation is a LOT more complicated then this! (and you thought this was already complicated!)


There are 22 different kinds of amino acids and they behave very differently. different strings of amino acid beads twist into different shapes and the amino acids interact in different ways to make each protein a very different structure. some bind together into fibers, others make doorways in the cell, others catalyze chemical reactions and others can walk along fibers and carry things around the cell.

the sequence code also tells the blueprint copiers when to start copying and when to stop and also specifies places to post bulletins about whether and when the sequence ahead or behind should be copied and how much it is currently being copied and all sorts of other things. Things like, if the cell next door sends a message to you telling you he is next to you, that message will be posted on this bullet en board somewhere... and it will effect the blueprint copiers and change which blueprints to copy at the moment.

the whole thing could get rather bewildering and we don't know all the complications yet.

a gene used to be what we called one sequence that stands for one blueprint to build ONE protein. but now we know it is a little messier, sometimes we call the regions that specify where to post bulletins part of the gene. Sometimes the blueprint copy gets cut up and rearranged in different ways to make different kinds of proteins from the same gene. the same kinds of signals that influence what's on the bulletin boards also influence how a blueprint is spliced up to make different genes.

anyway this complicated rigmarole actually works and helps cells coordinate their behavior and makes them distinct from cells of other creatures. each kind of critter has a distinct set of blueprints to direct it's activities and structures.


actually those 46 chromosomes are actually 2 pairs of 23. one set from each parent! hah! you actually contain two different libraries in you at the same time. they are pretty similar and USUALLY coordinate pretty well, in fact gives you some flexibility. if parents who are too different try to mate, say horses and donkeys, their child will be a mule, mostly works but when THEY try to breed they find that the libraries are too different, confusion sets in and breeding doesn't work. If the parents are WAY different, say, a horse and a deer, the libraries will contain such conflicting information that the cell containing them won't even be able to function very far and make a baby.



HOW THE SAME CHROMOSOME LIBRARY IN EACH CELL OF A CRITTER TELLS EACH CELL HOW TO BE DIFFERENT TO MAKE THE DIFFERENT ORGANS OF THE CRITTER.

back to your initial cell. when it splits into two 'daughter cells' each has MOSTLY the same components of the original cell, but they copy the whole set of 46 strands of chromosomes into two IDENTICAL copies one per each cell. These two daughters also split into two daughters each, and so on... Eventually the100billion cells in your body have (MOSTLY, the differences are in the genes for the immune system, another fascinating topic!) the same sets of 46 chromosome libraries. each cell has identical genetic information.

how then does each organ come out different? Two causes. The original eggcell actually is NOT symmetrical! When it splits into two daughters, then 4 etc... even though each daughter cell has IDENTICAL chromosome libraries, each daughter cell will differ in other cell components, various small molecules because the original egg had some components in one side different components on the other side, etc..

Now the bulletin board parts of the libraries come into play. If cell A has more molecule a than b in it, then molecule a will stick to its bulletin board and turn on gene C. If cell B has more molecule b than a in it, then molecule b will stick on that bulletin board and turn OFF gene C

Now the two cells will start functioning differently... They will have daughter cells each with identical genes from their mother cells, and having mostly the same small molecules but some different bulletin board posts from their mother cells...

eventually, each cell is surrounded by different kinds of cells. now cell - cell signalling comes into play. cells will also send signals to their neighbors that get posted on various chromosome bulletin boards. and in this way, each cell's neighbors effect what genes that cell will be copying and using and thus cells neighboring cells will cause each other to change even more... eventually you get an embryo growing with all kinds of different cells. Then the different kinds of cells can tell where they are in the body, because their neighbors signal to them and thus they can form the different organs..

It was important all the while, even though many different kinds of cells are forming, that the libraries are all identical. because eventually some of these different kinds of cells, must become new eggs and sperms, and they have to have the identical libraries in them from the parents. If the libraries, the genes themselves were all scrambled up and scribbled on with all the bulletins, the children that come from the next generation of eggs would be WAY TOO different from their parents and wouldn't make a very viable critter.

so to make a new egg, all the bulletins have to be cleared off the chromosomes? ah... that's a subtle question!


These different when a cell finds itself in a different positions with different neighbors in your growing embryo, it begins to post different BULLETINS on the dna next to the appropriate genes telling the other machinery in the cell whether to use those particular blueprints or not. eventually the different cells come to have different looking bulletin boards specifying different parts of the library that are to be read. same library in each cell, just different cells read different books in it according to their task.

Thursday, July 9, 2009

Where Does the Wealth Of Variety In Chemistry Come From? Math!

Physical properties of substances have to do with the relocation of electrons. Of stacking electron orbitals.

So...

neon starts of with 8 electrons and none in the outer shell. neon is a quiet inert atom. it doesn't engage in much chemistry. Add one electron to that outer shell however and you get sodium a highly reactive metal that wants to give up that lone electron. So Sodium cations swim in a sea of shiny malleable wandering valence electrons.

Add yet another electron to the mix and we have 2 electrons in the outer shell. anothe slightly less reactive metal, magnesium. Add another electron to the outer shell and now we have a total new orbital and we get aluminum, less reactive and the transition from MgO a soluble opaqe soft crystal to Al2O3 a nonsoluble transparent very hard crystal: ruby.

Add yet another electron and we get another orbital, silicon. A softer metal again but it's oxide SiO4 now can form dozens of varieties of chains and rings and matrixes which give us our vast variety of minerals on Earth: quartz, feldspar, mica..

Add yet another electron and we get a third orbital, phosphorus, a very reactive P4, nonmetalic spongy stuff, and PO4 cannot form stable chains at all, no vast variety of minerals, it forms instead, an acid.

Add another electron, no new orbital, start filling in the old ones and we get Sulfur, S8 a harder nonreactive solid, and S02 is now a gas. Add another electron and we get chlorine, Cl2 a highly reactive gas, and ClO is i don't know what.

Add another electron and all the orbitals are full again and once again we have argon, an inert element who engages in no chemistry at all.


To what do we owe this INTERESTING wealth of variety? The variety of chemistry is fascinating yet not totally chaotic. It all comes eventually from mathematics, Which is one of the recurring themes of complexity lab.

The relationships between these electron orbitals are determined by their energy level, their arrangement in space. Which are ultimately determined by the properties of solutions to a complex set of shrodinger's partial differential equations. Solutions that make different structures in 3 dimensional space. It would take us too far afield to explain these solutions (a few years of calcullus actually...), so we will present a simpler example: numbers.


What could be simpler than the numbers: 1, 2, 3, 4...

Lets see what happens to them every time we add one to the previous number to get the next. Just like we added one electron at a time to our elements.

1 is a unique number. 2 is the first prime number and peculiar because it is even. 3 is the first odd prime number. 4 all of a sudden is composite 2X2. 5 is prime again. 6 is now composite with TWO DIFFERENT factors 2X3. 7 is prime again. 8 is very composite 2X2X2 if we like we can consider it 3 dimensional. The next number? a prime again? NO, it's composite also; 9; 3X3. The next is composite also 10; 2X5. 8 seems to stand out as a lonely 3 dimensional number here. 11 is prime. 12 is the first example of a number with 2 different factorizations 2X6 or 3X4. Or you can call it also, 3 dimensional 2X2X3. 13 is prime again.

You get the drift. by simply adding 1 to the number we change the MULTIPLICITIVE (or geometric) properties of the numbers in unpredictable interesting ways. This is one of the simplest examples of how mathematics can give us the spice of life, the variety in the world that we see around us.

Wednesday, June 17, 2009

References on Newton and God

a general introduction can be found in Edward B. Davis' chapter in the recent book:


Galileo Goes to Jail and Other Myths about Science and Religion
by Ronald L. Numbers

In it he states that Newton was not a deist but believed it was blasphemy to think that God did not constantly interact with his creation. He bases this on some letters between his associate Samuel Clarke, and Leibniz

H. G. Alexander "the Leibniz - Clarke correspondence" Manchester U. pr. 1956 pg 11-12, 14

more info maybe here also:

"God of Gods, and Lord of Lords: the theology of Isaac Newton's General Scholium to the principia" Stephen D. Snobelen, Osiris #16 (2001) pgs 169-208


hmm apparently Newton was a very complicated fellow. here is a bbc presentation on his life

What Is Newton Trying To Say About God In His Opticks?

This is from query 32 of Newton's Opticks. Online here:

In this query he has been discussing all the chemistry he knows and wondering about the laws of physics that govern the particles of matter.

In it, he wonders about how the universe began, how the motions keep going given that there are inelastic collisions and friction in fluids and all motion must eventually cease.

In it he has a role for God at the beginning setting it in motion intelligently.

What i can't figure out from this passage is whether he has a role for God continuously prodding his creation, so it doesn't run down. I had seen arguments that Newton thought God must be doing so or else the chaotic motions of the solar system would eventually wreck it. these arguments are based on this passage:

For while Comets move in very excentrick Orbs in all manner of Positions, blind Fate could never make all the Planets move one and the same way in Orbs concentrick, some inconsiderable Irregularities excepted which may have risen from the mutual Actions of Comets and Planets upon one another, and which will be apt to increase, till this System wants a Reformation.

from pg 378 below

but i don't see that their claim is supported by this passage.


What follows is half of query 32 broken up by me and notes inserted by me in uppercase. ( the page numbers appear thusly: <378>)

Notice how much Newton is thinking about and how hard it is to wrap ones head around what he is writing!

more references here

START HERE***

And thus Nature will be very conformable to her self and very simple, performing all the great Motions of the heavenly Bodies by the Attraction of Gravity which intercedes those Bodies, and almost all the small ones of their Particles by some other attractive and repelling Powers which intercede the Particles.
THE LAWS THUS FAR DO NOT SHOW HOW THE UNIVERSE STARTED
The Vis inertiæ is a passive Principle by which Bo <373> dies persist in their Motion or Rest, receive Motion in proportion to the Force impressing it, and resist as much as they are resisted. By this Principle alone there never could have been any Motion in the World.

INELASTIC COLLISIONS SHOW THAT THE MOTIONS WILL DISSIPATE
Some other Principle was necessary for putting Bodies into Motion; and now they are in Motion, some other Principle is necessary for conserving the Motion. For from the various Composition of two Motions, 'tis very certain that there is not always the same quantity of Motion in the World. For if two Globes joined by a slender Rod, revolve about their common Center of Gravity with an uniform Motion, while that Center moves on uniformly in a right Line drawn in the Plane of their circular Motion; the Sum of the Motions of the two Globes, as often as the Globes are in the right Line described by their common Center of Gravity, will be bigger than the Sum of their Motions, when they are in a Line perpendicular to that right Line. By this Instance it appears that Motion may be got or lost.

But by reason of the Tenacity of Fluids, and Attrition of their Parts, and the Weakness of Elasticity in Solids, Motion is much more apt to be lost than got, and is always upon the Decay. For Bodies which are either absolutely hard, or so soft as to be void of Elasticity, will not rebound from one another. Impenetrability makes them only stop. If two equal Bodies meet directly in vacuo, they will by the Laws of Motion stop where they meet, and lose all their Motion, and remain in rest, unless <374> they be elastick, and receive new Motion from their Spring. If they have so much Elasticity as suffices to make them rebound with a quarter, or half, or three quarters of the Force with which they come together, they will lose three quarters, or half, or a quarter of their Motion. And this may be tried, by letting two equal Pendulums fall against one another from equal heights. If the Pendulums be of Lead or soft Clay, they will lose all or almost all their Motions: If of elastick Bodies they will lose all but what they recover from their Elasticity. If it be said, that they can lose no Motion but what they communicate to other Bodies, the consequence is, that in vacuo they can lose no Motion, but when they meet they must go on and penetrate one anothers Dimensions.

DECAY OF MOTION IN LIQUIDS DUE TO FRICTION
If three equal round Vessels be filled, the one with Water, the other with Oil, the third with molten Pitch, and the Liquors be stirred about alike to give them a vortical Motion; the Pitch by its Tenacity will lose its Motion quickly, the Oil being less tenacious will keep it longest, but yet will lose it in a short time.
LOSS OF MOTION IN THE HEAVENS?
Whence it is easy to understand, that if many contiguous Vortices of molten Pitch were each of them as large as those which some suppose to revolve about the Sun and fix'd Stars, yet these and all their Parts would, by their tenacity and stiffness, communicate their Motion to one another till they all rested among themselves. Vortices of Oil or Water, or some fluider Matter, might <375> continue longer in Motion; but unless the Matter were void of all Tenacity and Attrition of Parts, and Communication of Motion, (which is not to be supposed) the Motion would constantly decay.


IF DECAY, THEN MOTION MUST BE RECRUITED BY ACTIVE PRINCIPLES:
Seeing therefore the variety of Motion which we find in the World is always decreasing, there is a necessity of conserving and recruiting it by active Principles, such as are the cause of Gravity, by which Planets and Comets keep their Motions in their Orbs, and Bodies acquire great Motion in falling;

and the cause of Fermentation, by which the Heart and Blood of Animals are kept in perpetual Motion
and Heat; the inward Parts of the Earth are constantly warm'd, and in some places grow very hot; Bodies burn and shine, Mountains take fire, the Caverns of the Earth are blown up, and the Sun continues violently hot and lucid, and warms all things by his Light. For we meet with very little Motion in the World, besides what is owing to these active Principles. And if it were not for these Principles the Bodies of the Earth, Planets, Comets, Sun, and all things in them would grow cold and freeze, and become inactive Masses; and all Putrefaction, Generation, Vegetation and Life would cease, and the Planets and Comets would not remain in their Orbs.

I DON'T UNDERSTAND, HOW CAN GRAVITY BE AN ACTIVE PRINCIPLE? IT'S NOT A SOURCE OF ENERGY! NEWTON IS CONFUSED.


GOD CREATED HARD PARTICLES IN THE BEGINING. SINCE THE NATURE OF WATER CANNOT CHANGE IN TIME, THESE PARTICLES WHICH GIVE IT PROPERTIES ARE NONDESTRUCTIBLE: ATOMS
All these things being consider'd, it seems probable to me, that God in the Beginning form'd Matter in solid, massy, hard, impenetrable, moveable Particles, of such Sizes and Figures, and with such other Properties, and in such Proportion <376> to Space, as most conduced to the End for which he form'd them; and that these primitive Particles being Solids, are incomparably harder than any porous Bodies compounded of them; even so very hard, as never to wear or break in pieces: No ordinary Power being able to divide what God himself made one in the first Creation. While the Particles continue entire, they may compose Bodies of one and the same Nature and Texture in all Ages: But should they wear away, or break in pieces, the Nature of Things depending on them, would be changed. Water and Earth composed of old worn Particles and Fragments of Particles, would not be of the same Nature and Texture now, with Water and Earth composed of entire Particles, in the Beginning. And therefore that Nature may be lasting, the Changes of corporeal Things are to be placed only in the various Separations and new Associations and Motions of these permanent Particles; compound Bodies being apt to break, not in the midst of solid Particles, but where those Particles are laid together, and only touch in a few Points.

It seems to me farther, that these Particles have not only a Vis inertiæ, accompanied with such passive Laws of Motion as naturally result from that Force, but also that they are moved by certain active Principles, such as is that of Gravity, and that which causes Fermentation, and the Cohesion of Bodies.
These Principles I consider not as occult Qualities, supposed to result from the specifick Forms of Things, but <377> as general Laws of Nature, by which the Things themselves are form'd: their Truth appearing to us by Phænomena, though their Causes be not yet discover'd.

For these are manifest Qualities, and their Causes only are occult.

WHAT'S HE MEAN BY OCCULT MERELY HIDDEN AS OPPOSED TO MANIFEST?

And the Aristotelians gave the Name of occult Qualities not to manifest Qualities, but to such Qualities only as they supposed to lie hid in Bodies, and to be the unknown Causes of manifest Effects: Such as would be the Causes of Gravity, and of magnetick and electrick Attractions, and of Fermentations,

if we should suppose that these Forces or Actions arose from Qualities unknown to us, and uncapable of being discovered and made manifest.

Such occult Qualities put a stop to the Improvement of natural Philosophy, and therefore of late Years have been rejected. To tell us that every Species of Things is endow'd with an occult specifick Quality by which it acts an produces manifest Effects, is to tell us nothing:

But to derive two or three general Principles of Motion from Phænomena, and afterwards to tell us how the Properties and Actions of all corporeal Things follow from those manifest Principles, would be a very great step in Philosophy, though the Causes of those Principles were not yet discover'd: And therefore I scruple not to propose the Principles of Motion above mention'd, they being of very general Extent, and leave their Causes to be found out.


THE UNIVERSE WAS CREATED BY AN INTELLIGENT AGENT NOT BY LAWS OUT OF CHANCE CHAOS
Now by the help of these Principles, all material Things seem to have been composed of <378> the hard and solid Particles above mention'd, variously associated in the first Creation by the Counsel of an intelligent Agent.

For it became him who created them to set them in order.

And if he did so, it's unphilosophical to seek for any other Origin of the World, or to pretend that it might arise out of a Chaos by the mere Laws of Nature;

though being once form'd, it may continue by those Laws for many Ages.

IT LOOKS LIKE CHAOS OUT THERE IN THE COMETS SO HOW COULD THE PLANETS COME TO MOVE ALL IN ONE DIRECTION CONCENTRIC BY LAWS FROM CHAOS?
For while Comets move in very excentrick Orbs in all manner of Positions, blind Fate could never make all the Planets move one and the same way in Orbs concentrick, some inconsiderable Irregularities excepted which may have risen from the mutual Actions of Comets and Planets upon one another, and which will be apt to increase, till this System wants a Reformation.

NO STATEMENT THOUGH THAT THIS IS WHAT will HAPPEN AND GOD MUST CONTINUE TO FIX IT. HMMM*****

Such a wonderful Uniformity in the Planetary System must be allowed the Effect of Choice.

SO TOO IT'S OBVIOUS THE CONTRIVANCES OF ANIMALS ARE DESIGNED
And so must the Uniformity in the Bodies of Animals, they having generally a right and a left side shaped alike, and on either side of their Bodies two Legs behind, and either two Arms, or two Legs, or two Wings before upon their Shoulders, and between their Shoulders a Neck running down into a Back-bone, and a Head upon it; and in the Head two Ears, two Eyes, a Nose, a Mouth and a Tongue, alike situated. Also the first Contrivance of those very artificial Parts of Animals, the Eyes, Ears, Brain, Muscles, Heart, Lungs, Midriff, Glands, Larynx, Hands, Wings, Swimming Bladders, na <379> tural Spectacles, and other Organs of Sense and Motion; and the Instinct of Brutes and Insects,

can be the effect of nothing else than the

Wisdom and Skill of a powerful

ever-living Agent, who being in all Places, is more able by his Will to move the Bodies within his boundless uniform Sensorium, and thereby to

form and reform the Parts of the Universe,

than we are by our Will to move the Parts of our own Bodies.

IS HE SAYING HERE THAT THE AGENT IS continuously REFORMING THE PARTS, EACH GENERATION OR SOMETHING?

And yet we are not to consider the World as the Body of God, or the several Parts thereof, as the Parts of God. He is an uniform Being, void of Organs, Members or Parts, and they are his Creatures subordinate to him, and subservient to his Will;

and he is no more the Soul of them, than the Soul of a Man is the Soul of the Species of Things carried through the Organs of Sense into the place of its Sensation, where it perceives them by means of its immediate Presence, without the Intervention of any third thing.

THIS IS PUZZLING. HE IS TRYING TO FIGURE OUT so MUCH.

The Organs of Sense are not for enabling the Soul to perceive the Species of Things in its Sensorium, but only for conveying them thither; and God has no need of such Organs, he being every where present to the Things themselves. And since Space is divisible in infinitum, and Matter is not necessarily in all places, it may be also allow'd that God is able to create Particles of Matter of several Sizes and Figures, and in several Proportions to Space, and perhaps of different Densities and Forces, and thereby to vary the Laws of Nature, and make Worlds of several sorts in <380> several Parts of the Universe. At least, I see nothing of Contradiction in all this.

As in Mathematicks, so in Natural Philosophy, the Investigation of difficult Things by the Method of Analysis, ought ever to precede the Method of Composition. This Analysis consists in making Experiments and Observations, and in drawing general Conclusions from them by Induction, and admitting of no Objections against the Conclusions, but such as are taken from Experiments, or other certain Truths. For Hypotheses are not to be regarded in experimental Philosophy. And although the arguing from Experiments and Observations by Induction be no Demonstration of general Conclusions; yet it is the best way of arguing which the Nature of Things admits of, and may be looked upon as so much the stronger, by how much the Induction is more general. And if no Exception occur from Phænomena, the Conclusion may be pronounced generally. But if at any time afterwards any Exception shall occur from Experiments, it may then begin to be pronounced with such Exceptions as occur. By this way of Analysis we may proceed from Compounds to Ingredients, and from Motions to the Forces producing them; and in general, from Effects to their Causes, and from particular Causes to more general ones, till the Argument end in the most general. This is the Method of Analysis: And the Synthesis consists in assuming the Causes discover'd and establish'd as Principles, and by them explaining the Phæ <381> nomena proceeding from them, and proving the Explanations.

In the two first Books of these Opticks, I proceeded by this Analysis to discover and prove the original Differences of the Rays of Light in respect of Refrangibility, Reflexibility, and Colour, and their alternate Fits of easy Reflexion and easy Transmission, and the Properties of Bodies, both opake and pellucid, on which their Reflexions and Colours depend. And these Discoveries being proved, may be assumed in the Method of Composition for explaining the Phænomena arising from them: An Instance of which Method I gave in the End of the first Book. In this third Book I have only begun the Analysis of what remains to be discover'd about Light and its Effects upon the Frame of Nature, hinting several things about it, and leaving the Hints to be examin'd and improved by the farther Experiments and Observations of such as are inquisitive. And if natural Philosophy in all its Parts, by pursuing this Method, shall at length be perfected, the Bounds of moral Philosophy will be also enlarged. For so far as we can know by natural Philosophy what is the first Cause, what Power he has over us, and what Benefits we receive from him, so far our Duty towards him, as well as that towards one another, will appear to us by the Light of Nature. And no doubt, if the Worship of false Gods had not blinded the Heathen, their moral Philosophy would have gone farther than to the four Cardinal Virtues; and <382> instead of teaching the Transmigration of Souls, and to worship the Sun and Moon, and dead Heroes, they would have taught us to worship our true Author and Benefactor.

Monday, May 4, 2009

Atheist Vs Theist World View

silly labels, eh? realize that atheism is NOT one cohesive tradition. there is probably an authoritative book on the nature of the banana. there is probably NOT one on the nature of not-bananas. atheism is NOT a single tradition. and all of my answers are my own. atheists only have ONE thing in common:

that there can't possibly be a being something like a human mind that created the universe and Earth and all the critters and man and is inordinately fond of mankind in particular and has a plan for mankind and earth of punnishment and reward. and that this being can be communicated with unambiguously. Certainly no mind like being in control of the universe wrote us a book in a hman language. that's it.

and even that is questionable because what's this mean "something like a human mind" surely some think that the evolving earth is SOMEthing like the human mind since the human mind might ALSO work by a process of overproduction of varying 'thoughts' and a 'natural selection' of them. Who knows? we don't know how the mind works yet. and still these people might call themselves atheists. there is no arbitor of who can and cannot call themselves atheists.

so these answers are my own. and i am not sure i would call myself an atheist, because we don't know how minds work, therefore, even if there was a deity, i don't know how it would work.


There are the basic world view questions:
1) Origins: Where did life originate

This is the exciting advanture that science is on now. is life as we know it on earth a natural consequence of chemistry? is it rather inevitable that under cetain geochemical conditions the chemistry of CHNOPS and SiAlFeMgKCaNaCl spontaneously forms into life?

Or is life a one time low probability event?

Or is it so improbable that it had to be designed?

The point is that most people don't know what we've learned in teh past 150 years. What we've learned is that rocks and chemicals are not innert and dumb. the gyrating 20 odd elements the earth is mostly made of are dynamic information processing subtle fuzzy machines always bouncing into each other exploring, with complex behaviors! molecules are complex and have sublte behaviors. they are NOT only like bricks or lego blocks.

In the last 70 years we've learned the molecular nature of life. This is utterly mindblowing knowlege, that again, has not seeped into popular culture. Yes when you look at the molecular organization of the simplest cell, the first impression is yes, the whole shebang, the whole autopoeitic loop looks irreducibly complex.

on the other hand over that same time period we've been widening the scope of our exploration of chemistry. in school we may learn something kind of dopey like: a flame is C6H12O6 +O2-->CO2 +H2O. FAR FROM IT. even an ordinary gas flame, CH4 and O2 burns in a complicated network of cyclic chemical reactions, reminiscent of some of those in the cell. We've begun to explore many such cyclic reactions in chemistry that spontaneously form. We know that many of the small molecules in cells can form spontanously in a reducing atmosphere, in fact are present in meteorites.

and of course even mineral chemistry is complex. clays, zeolites, metal sulfides... in fact at the core of many living reactions are metal sulfides..

The bottom line is, that our knowlege of all this is exploding exponentially, this is an EXCITING time for exploring this question. the gap between non life and life is narrowing. this is NO time to back down into a stance of "it's impossible"


1.5) and humanity originate?
The question of whether humanity 'originated' is partially a mathematical one. The record shows that between the common ancestor of us and chimps to the first records of human culture 30,000 years ago is about 5million years. that's between a 250,000 and a million generations. children in each generation are born slightly differently, though there may be periods where differences are higher.

can we say at some point we were chimp/humans and some point human? is there a SINGLE GENERATION where we can point to the dividing line? This seems to me a silly idea.

Unless there was a discrete bifurcation in the properties or our neural nets. (here comes the mathematical part..) Or a very fast bifurcation in the network properties of our develpmental circuits or between them and ecological circuits...

We don't know. Waht we do know is that in early eocene strata and lower we find no bones that are remotely hominid, and in upper strata we find many. many different kinds over a period of 5 million years and 2million in earnest. how can 500 thousand generations of changes turn a chimp like critter into a human? if you can't imagine that happening in 500 thousand changes.. you need to learn some biology. learn that we are the results of analog physics helping incredibly complex cell factories interpret a discretely coded blueprint called our genes.


2) The Problem: Why is there suffering,

Because there is creativity! There is suffering because that is one way to create. to create means to say try this, NOT that. to not try that is to suffer, unless you can break your attachments to that. This life involves innevitable choices. try the Buddha way if this bothers you.

2.5) why is there sickness, and death?
more specifically, why are humans prone to horrifying diseases, insanities, social chaos? because if we were perfect we'd be impervious to fluctuations out of which evolution creates new beings. we'd be impervious to fluctuations out of which our minds try out new ideas. and finally if we were perfect, would we be lovable? would we be human at all?

Why death? some creatures don't quite die. but vertebrates accumulate so many diseases, wear out etc... it's easier to have kids, start from scratch than to keep repairing, a 100 year old carcass! Of course most critters don't have the story telling memories that we do, don't become so attached to their memories as we do, so this irks us.


3) The Solution: What is the cure for man's suffering,
The buddha way.

or, accept it. Judaism is one way to live with the glorious creativity of life and accept the suffering as a consequence of this creativity

you mean cure for diseases? some can be cured, more wil always evolve. it is the way of life. You didn't want to escape this life did you? here is the knife, go for it. i don't recommend it.


3.5) esp. his existential lonliness?
why do you want to CURE this? isn't it one of the things that define us as humans? we spend our lives trying to connect, trying to make meaning, trying to create before we die or set up connections to what has come before us and to who will come after. this is the human way. why you not like it?


Questions of Meaning and Value:
4) How does an atheist assign meaning to human activity?

same as the rest of us, if we love it, if it brings us what we love, it means something to us. what we love is partially determined by what we are like, partially a-rational. is this a problem?

Bar, you must address the common misconception that guitar chick stated: if no god, then life has no meaning, we can plunder, there is no daddy to come home to after death all is a veil of horror, it's a pathology you must address.

4.5) Is all meaning subjective, or do some activities have self-evident and objective worth and meaning. If so, what are these activities, and how to you arrive at their value?

see the answers to morals


5) Are humans of more intrinsic value than animals? Why or why not?

To other humans and some of their pets they are. If we manage master our warlike, our apocalyptic tendancies, we may even come to be able to defend our planet against large asteroid collisions, interplanetary invasion, and even spread this Earth's life to other planets, who knows? life and we have already spread quite spectacularly.

then again in the cosmic scheme of things? is the moon of more value than the earth? one cannot say. one can only say "i love earth, life, humans, and this particular human more" it is a-rational.

are humans such that they can apprehend the laws of physics and one day come to be able to CHANGE the laws of physics themselves? I cannot imagine any way to say that's impossible in 10,000 years of continued science. so who knows?


6) How does an atheist determine what is moral or immoral

as i said in item 1.5 there is probably no ONE definition for humanity, just as there is no ONE definition for how a mammal can live. we have an idea that humanity is a fixed thing. and therefore that there is a fixed moral code. i think this is wrong.

a better understanding is that there is a statistical distribution of ways to be human just as all other properties of various species are distributed and vary, and that our idea of a norm of humanity is based on the fact that some large percentage of us DO operate under the same basic root behaviors and morals. certainly psychopaths and people with severe brain damage do not.

SHOULD humanity hold to ONE norm? that is entirely another question. would it lead to more stability? Do clashing norms naturally lead to an armed apocalypse destroying civilization? Can you imagine a world society enforced to one way of life? i think it would be hell, and would require HELL to produce. Nazi germany, anyone?

in different cultures in differnt times people think differntly about this norm. in current amercian culture we are so attentive to this norm idea that we largely ignore the real range of humanity, we are so bent on forcing each other into a norm.

7) right or wrong.

right for who and when and where? again there is a broad consensus among many people on rights and wrongs, but it's NOT UNIVERSAL. gravity is universal. certain laws of ecology are universal, though at any point a new biological invention like plant life on land, or insect pollination or the development of animal societies can change them.

Bar you must address a specific instance like african genetal mutilation, or the hijab or nazi germany. or feminism. or the automobile, YOU think it's wrong. ecologically it is. But he's asking about kosmic ultimates. and i'm saying it DOES depend on context.


8) Is there any objective standard or principles?

that's what i'm saying. NO. it's dependent on the ecological milleu. On the current state of evolution or speciation of Homo sapiens.


Questions of Worldview:
7. What type of government does atheistic philosophy translate into? How does it understand the relationship between man and government?

I am not aware of a single type. Humanity is too complex to determine this i think. i think we are doomed to continual experimentation. there are certain guidelines, such as how stable creative ecosystems work by their interactions. We can learn how other mammal societies manage and whether some of those principles are appropriate for us or not, or whether they in fact DO operate among us and whether we WANT them to or not.

again, you want one fixed answer for all time. the evidence shows that this is NOT the way of life on this Earth. you want a reality more cozy than it is.


7.5) Does it merely rely on someone else's system of thought, like the assumptions of naturalistic science?

Some ONE else's? that's silly. government is when MANY people get together and knock out a creative agreement. and in the scheme of things perhaps governements will come to evolve as they interact with each other. after a few rounds of hellish war, maybe we'll learn. has europe learned or has she collapsed? interesting.

the assumptions of naturalistic science? these arent assumptions, they are observations of how ecosystems work, how humans work. we can base how to make governemtns partially on data of the world, partially on our own desires.



8. How does atheism view religions and religious faith?

obviously all ancient societies that we have record for have had religious civilizations. I think this is a reaction to the way we must have suddenly (see bifurcations in (1.5) above) awakened to the immense depths and horrifically tortuous passageways of our own minds. It has taken us a long time to get out of that nightmare, and back into this refreshing REAL world.

nevertheless, since humanity is not fixed there is no ONE answer for how to live. only a norm for MOSTLY how to live. The rest of the choices are left to what we LOVE. and how we love is a-rational.

and then there is the question of suffering. most of us grow up naturally loving some aspects of life, becoming attached to them and suffering thereby, because all is change. if you would like, you can define religion as a response to this.

Buddha way says practice letting go of attachements and you wont suffer. this is hard. This is a very hard path, not many are willing to put in the work.

tora way says accept the suffering, it's a necessary adjunct to creativity and individuality for humanity. celebrate it. this is also a hard path. very few take it.

I suppose these two are close to the atheist way.

the way of the cross says, suffer now, and after you die, you can escape that kind of reality. this is an easy path, billions take it.

untill we change the nature of reality, religion will be here.


8.5) What about metaphysics? Is atheism purely materialistic and naturalistic?

i don't know what those mean. what could possibly be unnatural?

answer the question is atheism purely rationalistic. ah..

9) Who are the authoritative writers/books of atheism?

there is probably an authoritative book on the nature of the banana. there is probably NOT one on the nature of not-bananas. atheism is NOT a single tradition. and all of my answers are my own.

10) What are the central tenets of atheism

that there can't possibly be a being something like a human mind that created the universe and Eaerth and all the critters and man and is inordinately fond of mankind in particular and has a plan for mankind and earth of punnishment and reward. and that this being can be communicated with unambiguously. Certainly no mind like being in control of the universe wrote us a book in a hman language. that's it.

what are the central tenets to MY view of life? oy vey.


11) and if they have a "greatest commandment," what is it? For example, arguably, Christianity's is "Love the Lord your God with all of your heart, mind, soul and strength, and love your neighbor as yourself."

again, atheism is NOT a single tradition. perhaps you are thinking of the recent phenomenon of Dawkins, Dennet, Hitchens, Schermer.. I've not read. Do you suppose even THEY agree?

greatest commandment to me? keep trying to do the next thing.



Questions of Revelation:
10. What happens after we die?

everyone else still alive, lives. oh, you mean to us? but that's the point eh? you want to keep holding on to your life. Well, it wasn't yours to begin with, let go.

Monday, April 27, 2009

Corn Starch Holes by Merkt, Deegan et. al. , kast55555,




from the description of this youtube entry:

I found this clip on the net some time ago and did a voice over to it...I also put Booker T. and the MG's as the soundtrack...

the video comes from the research here

F. Merkt, R.D. Deegan, D. Goldman, E. Rericha, and H.L. Swinney, �Persistent holes in a fluid�, Phys. Rev. Letters. 92 184501 (2004)

what is it? the fingers are self organizing structures feeding off of the vibrational energy supplied to the goop.

you can youtube corn starch and water and find all sorts of fun stuff.

you can make it yourself. easy.