A Quick Crazy Intro To Genes Chromosomes and DNA

first some fun movies:

chromosomes and dna:
http://www.youtube.com/watch?v=Pj9cdVeIntY

the rest of the city that a cell is:
http://www.youtube.com/watch?v=BVvvx5HGpLg



BODIES ARE BUILT OUT OF, AND BY, INTERACTING CELLS, JUST AS NATIONS ARE BUILT OUT OF, AND BY, INTERACTING CITIES

our bodies are confederations, societies, of living cells. Some cells can live independently. For instance, sperm cells can live for a few days if given the right nutrients and temperature, other cells for instance, single celled Amoebas, and Parameciums are entirely independent critters that can live all by themselves in ponds. But most of our cells are dependent on each other and stay together to make this society we call the human being.

Another important fact about cells is that cells give birth to other cells. There is no other way for living creatures to make cells from scratch. There are two ways that cells can give birth to new cells: asexual reproduction (mitosis) and sexual reproduction. In asexual reproduction the cell copies it's insides and splits into two genetically identical halves. now there are two living cells where there was once one.

In sexual reproduction, two different cells will come together, commingle their parts (genes and all) and then mix and match their genes and then separate into 4 DIFFERENT cells. The reason for 4 and the mechanics of this complicated process i will explain later.


You are a society of cells that started out as a single cell colonist inside your mom's body, one fertilized egg in her fallopian tube. This cell, this living creature, proceeded to reproduce asexually, just growing and then splitting in half and then the halves splitting in half and so on... they ate your mom's juices and held together and crawled all over each other till they built the society that was you.

How did they do it? how did they know to build you and not a starfish or elephant? It was in their genes. like this:


CELLS USE LIBRARIES, BLUEPRINTS, PROTEINS AND PROTEIN BUILDING FACTORIES TO BUILD THEMSELVES AND FUNCTION

When i said that you are a society of cells, i actually should have said that you are a nation of different cities! Each cell is as complicated as a whole city with all kinds of roads and buildings and machines and construction workers and decision makers... Each cell/city can come to specialize in certain crafts and trade with each other in this nation that is you. For instance red blood cells trade oxygen with the lungs and bring it to other parts of the body. intestine cells digest food from the stomach and trade it with liver cells in return for processing of the food. And on and on. Our bodies have over 250 different kinds of cells all working together to make us.

Each cell has a library of genes from which it copies blueprints to send out to construction sites in the cell to do all of it's construction. the library of genes also has bulletin boards for posting notes on the current stages of construction so the thing can be coordinated.

the library is in the form of 48 separate chromosomes. each chromosome is a superduperduperdupercoiled strand of DNA double helix with some complications (watch the movie of how a strand of dna twists into a chromosome!) Think of the old fashioned telephone cords. they are a little wider than thick in cross section, almost like a ribbon, and coiled like a helix spiralled around itself. Most of the time it gets even more twisted and supercoils around itself! The DNA strand is shaped like the phone cord, wider than thick because it's actually two strands parallel to each other.

each string is actually a string of beads of 4 types. 4 different kinds of Nucleotides. A, C, G or T. so one string looks like AACCGTCCCTAG... the other string will look like TTGGCAGGGATC... They match up; the As connecting to the Ts and the Cs connecting to the Gs to make a kind of ribbon:

AT
AT
CG
CG
GC
TA
CG
CG
CG
AT
GC
..
..
..

and that ribbon, twists around to make the double helix.


A sequence of these 4 types of nucleotides spells out in a kind of Morse code, one specifying the sequence of amino acids to string together and make a protein. A different sequence of amino acids makes a different protein. So a different sequence of nucleotides makes a different protein. This sequence of nucleotides is what is called a gene. There are many gene sequences strung out one after another on each of these chromosomes.

but each chromosome is a ribbon made of two different strings of nucleotide beads. The blueprints that are sent to the protein making factories are called messenger RNA. RNA is like DNA; it's also made of strings of nucleotides. But the RNA strings don't form DOUBLE helices, only single strings. Just as the two DNA strands compliment each other A for T and C for G, the RNA copy will compliment ONLY one of the DNA strands with a minor hitch: A for T and U for C, no G.

so from a chromosome that looks like this:

AACCGTCCCTAG...
TTGGCAGGGATC...

The cell will copy off an RNA blueprint like this from the top strand: TTUUCAUUUATC.

are there TWO different codes on each double helix then? Are there different genes on each strand of the double helix? This is a good question. Notice that the two strands compliment each other every where on one strand where there is a T the other strand has an A, etc.. So the two strands don't really say anything DIFFERENT, if you know the sequence from one strand you can figure out the sequence opposite it on the other strand.

In certain viruses, the answer to your question is YES, you can get different genes on each strand, like this:

AACCGTCCCTAG...
TTGGCAGGGATC...

one gene might start with the second A at the top and read ACCGTCCCTAG, and another gene might start at the bottom with the last C and run backwards (for reasons of the mechanics of the dna..) CTAGGGACGGTT...

For humans, i don't know the answer. I'll have to get back to you on that.


The proteins are also like strings of beeds. More like chains. Chains of different amino acids. There are 22 different kinds of amino acids, each a different shape, each having a different kind of stickiness to the other amino acids in the chain and to the water which bathes everything in a cell. these chains also twist and coil, depending on how the different amino acids stick to each other and interact with the water and the protein folds up into complicated shapes that either become certain building blocks, or even little dynamic machines!



When a blueprint of a gene sequence is copied and sent to a protein factory called a ribosome, the workers (called transfer RNA) read the sequence off 3 nucleotides at a time: AAC CGT CCC TAG... For each triplet they add another amino acid to the growing chain to make a protein. Which amino acid depends on the triplet pattern: AAC might mean leucine, CGT might mean methionine, etc...

Proteins are made of from a few hundred to a few thousand amino acids, so genes are from many hundreds to many thousands of nucleotides long. 30,000 genes on 48 chromosomes...


The next question is where do the genes start. Well there are special codes for starting and stopping points. AAA is start, TTT is stop [fix this]

so this strand:
CTACCCAAAACTAGGCGGTTTGTAACTAAACCCGCTACCTTATTTGGG

will have two genes: one starting AAA ACT AGG CGG TTT and another one starting AAA CCC GCT ACT TTA TTT. note there is other stuff between the genes (of course this example is abbreviated so i don't show the 100s of nucleotides for each gene). In fact, the situation is a LOT more complicated then this! (and you thought this was already complicated!)


There are 22 different kinds of amino acids and they behave very differently. different strings of amino acid beads twist into different shapes and the amino acids interact in different ways to make each protein a very different structure. some bind together into fibers, others make doorways in the cell, others catalyze chemical reactions and others can walk along fibers and carry things around the cell.

the sequence code also tells the blueprint copiers when to start copying and when to stop and also specifies places to post bulletins about whether and when the sequence ahead or behind should be copied and how much it is currently being copied and all sorts of other things. Things like, if the cell next door sends a message to you telling you he is next to you, that message will be posted on this bullet en board somewhere... and it will effect the blueprint copiers and change which blueprints to copy at the moment.

the whole thing could get rather bewildering and we don't know all the complications yet.

a gene used to be what we called one sequence that stands for one blueprint to build ONE protein. but now we know it is a little messier, sometimes we call the regions that specify where to post bulletins part of the gene. Sometimes the blueprint copy gets cut up and rearranged in different ways to make different kinds of proteins from the same gene. the same kinds of signals that influence what's on the bulletin boards also influence how a blueprint is spliced up to make different genes.

anyway this complicated rigmarole actually works and helps cells coordinate their behavior and makes them distinct from cells of other creatures. each kind of critter has a distinct set of blueprints to direct it's activities and structures.


actually those 46 chromosomes are actually 2 pairs of 23. one set from each parent! hah! you actually contain two different libraries in you at the same time. they are pretty similar and USUALLY coordinate pretty well, in fact gives you some flexibility. if parents who are too different try to mate, say horses and donkeys, their child will be a mule, mostly works but when THEY try to breed they find that the libraries are too different, confusion sets in and breeding doesn't work. If the parents are WAY different, say, a horse and a deer, the libraries will contain such conflicting information that the cell containing them won't even be able to function very far and make a baby.



HOW THE SAME CHROMOSOME LIBRARY IN EACH CELL OF A CRITTER TELLS EACH CELL HOW TO BE DIFFERENT TO MAKE THE DIFFERENT ORGANS OF THE CRITTER.

back to your initial cell. when it splits into two 'daughter cells' each has MOSTLY the same components of the original cell, but they copy the whole set of 46 strands of chromosomes into two IDENTICAL copies one per each cell. These two daughters also split into two daughters each, and so on... Eventually the100billion cells in your body have (MOSTLY, the differences are in the genes for the immune system, another fascinating topic!) the same sets of 46 chromosome libraries. each cell has identical genetic information.

how then does each organ come out different? Two causes. The original eggcell actually is NOT symmetrical! When it splits into two daughters, then 4 etc... even though each daughter cell has IDENTICAL chromosome libraries, each daughter cell will differ in other cell components, various small molecules because the original egg had some components in one side different components on the other side, etc..

Now the bulletin board parts of the libraries come into play. If cell A has more molecule a than b in it, then molecule a will stick to its bulletin board and turn on gene C. If cell B has more molecule b than a in it, then molecule b will stick on that bulletin board and turn OFF gene C

Now the two cells will start functioning differently... They will have daughter cells each with identical genes from their mother cells, and having mostly the same small molecules but some different bulletin board posts from their mother cells...

eventually, each cell is surrounded by different kinds of cells. now cell - cell signalling comes into play. cells will also send signals to their neighbors that get posted on various chromosome bulletin boards. and in this way, each cell's neighbors effect what genes that cell will be copying and using and thus cells neighboring cells will cause each other to change even more... eventually you get an embryo growing with all kinds of different cells. Then the different kinds of cells can tell where they are in the body, because their neighbors signal to them and thus they can form the different organs..

It was important all the while, even though many different kinds of cells are forming, that the libraries are all identical. because eventually some of these different kinds of cells, must become new eggs and sperms, and they have to have the identical libraries in them from the parents. If the libraries, the genes themselves were all scrambled up and scribbled on with all the bulletins, the children that come from the next generation of eggs would be WAY TOO different from their parents and wouldn't make a very viable critter.

so to make a new egg, all the bulletins have to be cleared off the chromosomes? ah... that's a subtle question!


These different when a cell finds itself in a different positions with different neighbors in your growing embryo, it begins to post different BULLETINS on the dna next to the appropriate genes telling the other machinery in the cell whether to use those particular blueprints or not. eventually the different cells come to have different looking bulletin boards specifying different parts of the library that are to be read. same library in each cell, just different cells read different books in it according to their task.

Where Does the Wealth Of Variety In Chemistry Come From? Math!

Physical properties of substances have to do with the relocation of electrons. Of stacking electron orbitals.

So...

neon starts of with 8 electrons and none in the outer shell. neon is a quiet inert atom. it doesn't engage in much chemistry. Add one electron to that outer shell however and you get sodium a highly reactive metal that wants to give up that lone electron. So Sodium cations swim in a sea of shiny malleable wandering valence electrons.

Add yet another electron to the mix and we have 2 electrons in the outer shell. anothe slightly less reactive metal, magnesium. Add another electron to the outer shell and now we have a total new orbital and we get aluminum, less reactive and the transition from MgO a soluble opaqe soft crystal to Al2O3 a nonsoluble transparent very hard crystal: ruby.

Add yet another electron and we get another orbital, silicon. A softer metal again but it's oxide SiO4 now can form dozens of varieties of chains and rings and matrixes which give us our vast variety of minerals on Earth: quartz, feldspar, mica..

Add yet another electron and we get a third orbital, phosphorus, a very reactive P4, nonmetalic spongy stuff, and PO4 cannot form stable chains at all, no vast variety of minerals, it forms instead, an acid.

Add another electron, no new orbital, start filling in the old ones and we get Sulfur, S8 a harder nonreactive solid, and S02 is now a gas. Add another electron and we get chlorine, Cl2 a highly reactive gas, and ClO is i don't know what.

Add another electron and all the orbitals are full again and once again we have argon, an inert element who engages in no chemistry at all.


To what do we owe this INTERESTING wealth of variety? The variety of chemistry is fascinating yet not totally chaotic. It all comes eventually from mathematics, Which is one of the recurring themes of complexity lab.

The relationships between these electron orbitals are determined by their energy level, their arrangement in space. Which are ultimately determined by the properties of solutions to a complex set of shrodinger's partial differential equations. Solutions that make different structures in 3 dimensional space. It would take us too far afield to explain these solutions (a few years of calcullus actually...), so we will present a simpler example: numbers.


What could be simpler than the numbers: 1, 2, 3, 4...

Lets see what happens to them every time we add one to the previous number to get the next. Just like we added one electron at a time to our elements.

1 is a unique number. 2 is the first prime number and peculiar because it is even. 3 is the first odd prime number. 4 all of a sudden is composite 2X2. 5 is prime again. 6 is now composite with TWO DIFFERENT factors 2X3. 7 is prime again. 8 is very composite 2X2X2 if we like we can consider it 3 dimensional. The next number? a prime again? NO, it's composite also; 9; 3X3. The next is composite also 10; 2X5. 8 seems to stand out as a lonely 3 dimensional number here. 11 is prime. 12 is the first example of a number with 2 different factorizations 2X6 or 3X4. Or you can call it also, 3 dimensional 2X2X3. 13 is prime again.

You get the drift. by simply adding 1 to the number we change the MULTIPLICITIVE (or geometric) properties of the numbers in unpredictable interesting ways. This is one of the simplest examples of how mathematics can give us the spice of life, the variety in the world that we see around us.