<?xml version='1.0' encoding='UTF-8'?><?xml-stylesheet href="http://www.blogger.com/styles/atom.css" type="text/css"?><feed xmlns='http://www.w3.org/2005/Atom' xmlns:openSearch='http://a9.com/-/spec/opensearchrss/1.0/' xmlns:georss='http://www.georss.org/georss' xmlns:gd='http://schemas.google.com/g/2005' xmlns:thr='http://purl.org/syndication/thread/1.0'><id>tag:blogger.com,1999:blog-4971718010905276598</id><updated>2012-02-02T18:33:05.363-05:00</updated><category term='religion'/><category term='poetry'/><category term='biology'/><category term='general'/><category term='science'/><title type='text'>blackskimmerblog</title><subtitle type='html'>A Celebration of the Rich Fragrant Chaos of Life</subtitle><link rel='http://schemas.google.com/g/2005#feed' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/posts/default'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default?max-results=100'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/'/><link rel='hub' href='http://pubsubhubbub.appspot.com/'/><link rel='next' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default?start-index=101&amp;max-results=100'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><generator version='7.00' uri='http://www.blogger.com'>Blogger</generator><openSearch:totalResults>144</openSearch:totalResults><openSearch:startIndex>1</openSearch:startIndex><openSearch:itemsPerPage>100</openSearch:itemsPerPage><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-934866741938379901</id><published>2012-01-28T09:26:00.004-05:00</published><updated>2012-01-28T09:32:46.369-05:00</updated><title type='text'>Rembrandt at the American Museum Of Natural History</title><content type='html'>&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/-LniPm9yiwZE/TyQGEl41JAI/AAAAAAAAAPw/YhE_Q6nWRJA/s1600/AMNH%2BIbexes%2BChris.JPG"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 400px; height: 300px;" src="http://2.bp.blogspot.com/-LniPm9yiwZE/TyQGEl41JAI/AAAAAAAAAPw/YhE_Q6nWRJA/s400/AMNH%2BIbexes%2BChris.JPG" alt="" id="BLOGGER_PHOTO_ID_5702689704117609474" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;Gemsbok in the Carl Akely Hall of African Mammals&lt;br /&gt;(photo by Chris Randolph, thanks for reminding me of this!)&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;and now for some rembrandt:&lt;br /&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/-2HjVLduL55Q/TyQGX_O1AOI/AAAAAAAAAP8/Lf4lnQRjWG8/s1600/staalmeesters_ibexes.jpg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 400px; height: 271px;" src="http://3.bp.blogspot.com/-2HjVLduL55Q/TyQGX_O1AOI/AAAAAAAAAP8/Lf4lnQRjWG8/s400/staalmeesters_ibexes.jpg" alt="" id="BLOGGER_PHOTO_ID_5702690037338276066" border="0" /&gt;&lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-934866741938379901?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/934866741938379901/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=934866741938379901' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/934866741938379901'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/934866741938379901'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2012/01/rembrandt-at-american-museum-of-natural.html' title='Rembrandt at the American Museum Of Natural History'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://2.bp.blogspot.com/-LniPm9yiwZE/TyQGEl41JAI/AAAAAAAAAPw/YhE_Q6nWRJA/s72-c/AMNH%2BIbexes%2BChris.JPG' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-3998677100244926745</id><published>2012-01-08T09:36:00.003-05:00</published><updated>2012-01-28T16:00:51.739-05:00</updated><title type='text'>How to Think About a Worm Evolving Into a Bird</title><content type='html'>that's quite a stretch, yes... i mean where do all the parts come from right?  looks like the worm is some kind of simple clay and some artist with an imagination has to sculpt the bird parts out of the worm-clay&lt;br /&gt;&lt;br /&gt;that's a reasonable idea.  given that we come from a culture of artists and craftsmen and not the modern biology class.&lt;br /&gt;&lt;br /&gt;So the first step is to describe what kind of 'clay' we've discovered a worm is.  If we want to know how a worm can change into a bird, first of all, do you have any idea how a bird egg turns into a bird?  that would be a start.  I mean, how do you think birds get sculpted all around us everyday?  If I told you, you'd be more amazed than your disbelief that a worm could turn into one.&lt;br /&gt;&lt;br /&gt;so for a worm to evolve into a bird of course we mean that a worm gives birth to a bird, or of course that a worm gives birth to a slightly different worm that gives birth to a slightly different one, and eventually worms are hatching with nubby legs and eye spots, and eventually heart and lungs, and feathers and wings...  Seems incredible, eh?  but really what you want to start with is how does a bird give birth to a bird?  It lays an egg and the egg turns into a bird.  lets start there!  How does it happen?&lt;br /&gt;&lt;br /&gt;[and then you may have some vague notion that a bird is so different than a worm, that it has so many more complex parts and behaviors  that for this to happen the number of minute changes necessary is astronomical and couldn't happen in a 1000 years or a million years.  But that's just the point, you just have a VAGUE notion.  do you really know how to think about just HOW MANY changes are necessary?  and is it some kind of continuous sculpting or is there a discrete number of changes at all?  ARE animals made up of discrete parts that CAN be changed one part at a time?]&lt;br /&gt;&lt;br /&gt;of course in the egg that you eat, before it is fertilized, there is no bird structure.  WHERE DOES THE BIRD STRUCTURE COME FROM, that's your whole question.  where does the structure come from and then prior to that, where does the design for the structure come from, i mean it's pretty clear that there is some clever designs in a bird.&lt;br /&gt;&lt;br /&gt;[bar, i think the common notion of design is that a person designs something at least with an intention in mind, even thought the process may be an evolution by trial and error of ideas in mind.  so we need another word?  while the parts of the bird mostly work well, they werent put together in the bird with any intention. after i intentionally design a mechanism who's parts work well together, how would i describe the product? can't think of a word at the moment.]&lt;br /&gt;&lt;br /&gt;ok, well, how does the bird come about?  what is a bird?  A bird, like every other big animal and plant is a gigantic society of cooperating single celled amoebas that start off from a single amoeba that colonizes the food in the  egg.  The egg is the shore of a lush tropical island and a single livinig amoeba organism detaches from the society of amoebas that is the mother bird and washes up on that shore of a tropical island and starts eating.&lt;br /&gt;&lt;br /&gt;you've heard that you are made up of cells, all animals are.  what are they?  They are tiny individual organsisms.  perhaps you've watched some pond water under a microscope and watched amoebas and stentors and parameciums swimming around in there...  These  are real critters not so much more different than the animals that we are familiar with.  They swim about, they can smell, feel vibrations (hear) some can see light and dark, even react to moving edges of shadows... they have the same desires as we do, hunger, fleeing from harm, cold, hot, having to pee, wanting to find mates...  they have capacity for memory and the ability to explore and try things out and learn from mistakes.  they can eat and transform their food into internal organs and grow and eventually reproduce, some with mating and some just by splitting in half.&lt;br /&gt;&lt;br /&gt;they also exhibit variation in their children just as our children are not identical to us or each other.&lt;br /&gt;&lt;br /&gt;How do they do it? what's inside THEM? another hierarchical level of smaller cells?  no, what's inside cells, what ultimately makes life alive is another whole level of giganticism different than ours.  Just as each of us or a bird is huge beyond a cell's belief, made of a trillion of them, each cell is a stupendous squaredance of molecular assemblies.  there is business inside cells, processes, patterns, decision making loops, trial and error processes of creativity, on a stupendous scale.  a living cell is a squaredance of molecules, as many molecules as there are bricks in all of new york city.&lt;br /&gt;&lt;br /&gt;wander around in that city and walk by all the buildings and cars and people... and imagine that all the buildings are made of bricks, and that each brick is a kind of simple squrimy crawly robot that can interact with the other bricks and make simple mechanical decisions around each other as if it had a simple computer program subroutine written inside it with some if statements...&lt;br /&gt;&lt;br /&gt;now wander around that city and imagine all those bricks crawling around each other and forming patterns and building that city from the bottom up, a dynamic city that can grow it's own parts, take them apart and rebuild, redesign depending on its needs, ultimately able to reproduce itself and send forth a whole new city.&lt;br /&gt;&lt;br /&gt;So that's a single living cell.  With all that dynamism and bustling of moving, interacting, decision making parts, these living cells can respond to each other with creative subtlety and morph each other into different shaped cells and come together and create huge complex structures.&lt;br /&gt;&lt;br /&gt;I think the main problem in imagining how an egg can turn into an adult animal or how an animal can evolve into another kind of animal is that we really don't have a good sense for just how complex even the begining egg already is.  how responsive to circumstances and how able to explore and create... The complexity inside is just not something we have much experience with.  We certainly aint taught agbout it in school.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;So, the chicken egg is a yolky shore on which this single complex cell washes up.  what can it do?  Bear in mind throughout this description how the bird is not going to be sculpted from the outside by a few clumsy hands, but that it is going to be built, grown from the inside by dozens, thousands, MILLIONS, B I L L I O N S of these critters crawling around each other and growing more of each other.&lt;br /&gt;&lt;br /&gt;Is there anything we are familiar with to which we can compare it?  I'm not sure!&lt;br /&gt;&lt;br /&gt;Now that we know there are enough tiny construction workers INSIDE that growing bird embryo, lets show where all the detailed features come about.  Let's imagine a crew of construction workers about to build a wing.  The first thing they do is lay out a ground plan and arrange themselves into different crews.  One group agrees to work on bones, another group agrees to work on blood vesels, another on muscles, nerves, feathers...  so some of the workers lay themselvces out in a&lt;br /&gt;&lt;br /&gt;[ok, so i can lookup some of the developmental processes and describe them, how the cells crawl around, how they signal each other and decide based on who they are surrounded by and what signals they recieve they change thir professions from building inside of bone to outside of bone, from laying down skin to building feather shafts and then these split up into some building shafts and some building  feather vanes etc...&lt;br /&gt;&lt;br /&gt;...&lt;br /&gt;&lt;br /&gt;Fine, so now i've described to you that theres a society of tiny construction workers building the bird on that shore of yolk out of themselves.  But how do they KNOW how to do it?  where does the blueprint come from?  Ah, that comes to the heart of our understanding of the digital changes generation after generation whereby a worm can givce rise to a bird.&lt;br /&gt;&lt;br /&gt;Inside each living cell is an identical library of blueprints and bulletin boards.  This library of course is the DNA that makes up our genes.  Each blueprint has a bulletin board attached to it, by which ...&lt;br /&gt;&lt;br /&gt;Ok, just as the cells are construction workers in the growing embryo, inside the cells are the proteins (the molecular robots of which there are as many as there are bricks in nyc) which are the construction workers that build and maintain the growing cell.  Just like cells, these robots can tear down and build new robots, they can interact with each other, they can come together to make larger structures, they can process information, making basic level decisions based on signals supplied by the concentrations of small molecules and by contacting other robots.&lt;br /&gt;&lt;br /&gt;Some of these protein robots build dynamic scaffolding that shapes the cells.  Some of them act as sense organs on the surface of cells.  The sense organs can detect neighboring cells, which kind they are and they can also sense signal molecules that are sent from afar by other cells.  Others act as connectors that enable certain cells to attach to each other.  Other proteins act as information processing units, like simple logic gates in our computers or simple subroutines in complex computer programs.  All these robots come together to control the way cells behave and respond to their environment.&lt;br /&gt;&lt;br /&gt;Now inside that initial cell that detaches from the mother cell-society and lands on the yolk is the DNA library for making proteins.  It contains blueprints for about 10,000 different kinds of proteins.  I think that might correspond to how many different kinds of parts and professions of people that a large city might contain, continuiing the analogy of a cell being as complex as a bustling city.&lt;br /&gt;&lt;br /&gt;But at any one time, the cell is only building a few thousand kinds out of that repetoir of 10,000.  And this particular selection out of the possible 10,000 is what makes one cell act differently than another cell that is building a different set of protein robots.&lt;br /&gt;&lt;br /&gt;An important thing to mention about these prootein robots is how they 'decide' which robots to tear down, and which neww kinds to build.  well, attached to each robot blueprint is a bulletin board that specifies when and whether and how much that blueprint is to be read and used too construct another robot.  The existing protein-robots act together and integrate the signals coming from outside the cell (what other cells surround it and what signals from far away cells are being recieved) with the current goings on inside the cell and and depending on what's going on, will attach themselvces in various combinations to each bulletin board.  So, depending on the state of the cell and the state of its surroundings only certain proteins are being produced, and in certain amounts, and this process can even specify where in teh cell the proteins will go.&lt;br /&gt;&lt;br /&gt;These processes will even result in different sensory proteins being placed on the surface of the cell and different signal molecules being  sent out of the cell, so that the cell can communicate with other cells what THEY ought to be doing.&lt;br /&gt;&lt;br /&gt;Now we are getting close to how the form of the bird comes about!  Where does the feather come from?  What kind of design process is this?  Is there a blueprint in there with the shape of a feather on it?  Alas, no!  It's way crazier than THAT!  It's at this point we have to take a side road and talk about how complex pattern appears in this universe from very simple rules that are spread out across the system as opposed to being 'crafted' by 'craftsmen' with an overarching central plan in mind.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&amp;gt;&amp;gt;&amp;gt;&amp;gt;HERE IS WHY I CAN'T WRITE COMPLEXITY LAB MANUAL YET.  I NEED TO DISCOVER MORE (IN A GRAD PROGRAM) DISS'PATEEV! (actually, we might know enough detail about how the genetic ciruits specify forms in embryos now.  so maybe i gotta learn that.  but I think i need a nonmolecular/cellular analogy to help people without years of molec bio to understand!&lt;br /&gt;&lt;br /&gt;&amp;gt;&amp;gt;&amp;gt;the key thiing to explain is how simple local rules on a grid, or possessed by 100s of simple agents can come together cooperatively into complex geometric shapes.  So lets find a simple rule that will produce an intresteing complex shape and then ask:  how do you suppose we can specify the rules for a robot to draw this shape, or perhaps a 100 robots to swarm around and draw it.  ok, which example should i use?  langton's blob and highway?  it's a weird shape, too messy to use as an example.  now one of those worm dragons would be cool.  ok.  how about something from conway life?  does any simple seed bloom into a pattern that someone would find fascinating but easy to grasp?  r pentomino makes a mess.  can a random seed in evoloop grow into an evoloop?  (90 rules!)&lt;br /&gt;&lt;br /&gt;what's a simple way to specify the construction of a rough sketch of the mandelbrot set?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;COOPERATIVE/DISTRIBUTED PATTERN FORMATION&lt;br /&gt;Where does pattern come from?  snowflakes, frost on window panes, hurricanes, [damm, i can't think of any other intersting natural patterns other than living critters?  hmm... why the gap?  thats a problem.  the patterns in living critters come from a combination of molecular scale interactions and large scale properties of materials like surface tension and like the fibonacci spirals in plants coming from patterns of strain on the surface of the apical meristem.  hmm...  so of course we don't see many molecular scale patterns because we are too big, unless they anneal for long periods of time and form large crystals?  well there are feathery patterns of percolation, weird patterns in goethite..  there are some cloud patterns, there is the large scale weather pattern on earth as a whole, and the crazier looking one on jupiter and saturn.  the patterns of ice formation on europa, BZ if anyone bothered to look... bar, this is nothing like a BIRD WING! hmm...&lt;br /&gt;&lt;br /&gt;why do i have to move to mathematical games for that kiind of complexity?  the worm games, langton's ant, r-pentomino in conway life, mandelbrot set...  and ARE there examples of nonliving molecular scale pattern formation as complicated as those mathematical ones?  How to even hunt for them?&lt;br /&gt;&lt;br /&gt;THIS IS THE KEY GOAL OF COMPLEXITY LAB MANUAL AND FURTHER RESEARCH ON MY PART, TO BRIDGE THAT GAP.&lt;br /&gt;&lt;br /&gt;well, onward.  lets start with static: snowflakes.  Actually, we aren't terribly sure how snowflake patterns form.  We do understand that water molecules have shape, and have a certain geometry to the way their ends electromagnetically attract each other.  and how much the molecules can bend when attached to each other in large grops.  We know what amounts of energy are iinvolved in breakiing and forming those bonds.  we can more or less understand how water will form hexagonal symmetry.  we know how the subtle conditiions in clouds with their moisture contentt and temperatures and relative humidities will allow water molecules to bond to the surface of the growing snowflake and then come off again or affect how other water molecules bond.  how the curvature of the surface affects whether and where and how easily more molecules will bond.&lt;br /&gt;&lt;br /&gt;and then given these parameters, they specify a set of feedback loops in certain geometries which result in the shapes of snowflakes.&lt;br /&gt;&lt;br /&gt;Math is involved.  let me givce you some examples of how a set of rules of feedbacks in geometry will give you complicated shapes.&lt;br /&gt;&lt;br /&gt;1) fractal triangle: suppose we start with an equilateral triangle&lt;br /&gt;&lt;br /&gt;&amp;gt;&amp;gt;&amp;gt;&amp;gt;&amp;gt;bar, this is WAY TOO LONG A DIVERSION!&lt;br /&gt;&lt;br /&gt;...&lt;br /&gt;&lt;br /&gt;BACK TO EMBRYOLOGY&lt;br /&gt;so lets look at a simple set of feedback loops in a geometrical context made out of a small set of protein robots and their blueprints.  now i gotta describe hoxology that produces turings stripes leading to segment formation in embryos.  then how these systems can 'count' which segment they are on and initiate bud formation.  how other systems will expand buds, patterns of apoptosis in the bud that can lay out patterns of bones...  the fractal complexity of feathers?  well at least there's some work on pattern formation in butterfly wings.&lt;br /&gt;&lt;br /&gt;if we don't belive it we can show BZ, snowflakes and ... see those are nice but the digital nature of the genes i think is what can give us more interesting pattern than snowflakes and the ability of biologicall systems to form quick feedbacks to narrow responses to form more discrete boundaries than BZ?&lt;br /&gt;&lt;br /&gt;God, i need to learn more.  but there are plenty of math systems like langton's ant, and those worms with simple rules that create dragon shapes...  rule 110 creates complex structures.  gotta find more examples.  come on you got sayama's evo loops with like 90 rules with 9 states in each cell.  but living cells have 10,000 rules with god knows how many states.  oh.&lt;br /&gt;&lt;br /&gt;can we rebuild the langton self rep loop rules to form the loop from ONE cell?  That would be way cool.  it would basically be embrygenisis.  construct it stage by stage:&lt;br /&gt;&lt;br /&gt;1) 1:00000000--&amp;gt;2&lt;br /&gt;2) 0:00010000--&amp;gt;2&lt;br /&gt;3) 2:00020000--&amp;gt;3&lt;br /&gt;4) 0:00030000--&amp;gt;2&lt;br /&gt;5) 0:00000023--&amp;gt;4  etc...  would take weeks of hard work to do, maybe sayama could help.&lt;br /&gt;&lt;br /&gt;well, that's complexity lab manual.  I have't studied hoxology in detail, but i've got ennough math to intuit that diffequs on continuous gradients can create spike bifurcations. I Don't know exactly how the 90 rules for selfrep loop work, but i've worked enough examples that i'm sure if i look into it i'll see how those rules can produce structure and that i can probably make rules that produce more sturcture.  or for that matter the simplest random rules like 110 and langtons ant already givee curious structure.&lt;br /&gt;&lt;br /&gt;Now this is no longer an essay about how a worm can evolve into a bird.  but hell, who says the answer to that question is going to come simply?  What's the simplest i can boil this down to explain at least the direction and how complicated it would really be?  hmmm&lt;br /&gt;&lt;br /&gt;I think one of my problems is that I DON'T UNDERSTAND IN DETAIL say, the genetic circuits in segment formation, give rise to the turing mechanism of segment formation.  that's the point of complexity lab to write this book without the vague handwaving found in all the other books.  (do i really have detail notes on capra's book?)&lt;br /&gt;&lt;br /&gt;...&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-3998677100244926745?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/3998677100244926745/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=3998677100244926745' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3998677100244926745'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3998677100244926745'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2012/01/how-to-think-about-worm-evolving-into.html' title='How to Think About a Worm Evolving Into a Bird'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-948874016326625733</id><published>2011-10-06T21:27:00.004-05:00</published><updated>2011-11-20T19:54:31.618-05:00</updated><title type='text'>At Last, Kissed By a Maiden With Golden Hair</title><content type='html'>In the early morning coolness under the pin oaks on the sidewalk of the Placid Baker cafe, a Honey bee comes to sip sweet coffee from my lips. "come on bee, there's a whole cup of it over there!" but no, here she comes again the only woman to kiss me in a long time, yet i shoo her away, and finally where is she?  "oh, man has she fallen into the coffee?  Stupid bee you are supposed to have so much brain power, two hundred seventy skills each of you gals have!"&lt;br /&gt;&lt;br /&gt;I fish her out of the coffee and she flies to the window to dry herself off.  But i realize,  "wow, maybe being drenched in caffein is way too much for a tiny bee like her"  So i go into the cafe and get a cup of water and bathe her in it to wash the coffee off of her..&lt;br /&gt;&lt;br /&gt;Now she is staggering around in a sunspot on my table.  I hope she recovers.&lt;br /&gt;&lt;br /&gt;I watch her up close, my eyes an inch from her face, as she runs her legs along her toungue to clean it.  Her tongue as long as her whole leg, long enough to reach the golden nectar of deep flowers.&lt;br /&gt;&lt;br /&gt;I watch her dry herself off, up close her fur is golden.  First she rubs her hindlegs together, then hind leg on middle leg, then front legs from mouth to antenna clearing her senses... yup, probably more than 270 skills!  My thoughts run from kissing to engineering. "Where is the circuitry, little bee, to handle so many complex algorithms?  You've only got, what? a million neurons?"  I do a quick calculation: let's see..., I think it's only a hundred thousand packed into that pea sized head of hers stuffed mostly with the dozens of glands bees have.  That's some engineering feat, distributed processing, that we haven't mastered yet.&lt;br /&gt;&lt;br /&gt;Then my engineering calculations are distracted by a woman of MY species walking by, flaxen wild hair flowing garments of many colors, free, licking her lollypop she must have gotten from the Pioneer Bank around the corner.  The bee, startled, flies off, both gone.&lt;br /&gt;&lt;br /&gt;I go back to my coffee. it must have just been a dream.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-948874016326625733?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/948874016326625733/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=948874016326625733' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/948874016326625733'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/948874016326625733'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/10/at-last-kissed-by-maiden-with-golden.html' title='At Last, Kissed By a Maiden With Golden Hair'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-2901020292943435903</id><published>2011-10-05T17:17:00.003-05:00</published><updated>2011-10-06T21:35:06.589-05:00</updated><title type='text'>I Don't Want To Occupy Wall Street, I Want To Occupy Troy, NY, My Home Town!</title><content type='html'>When I hear the phrase  'occupy Wall Street'  what comes to mind is that I wish to fully occupy the city that I chose to call my home, Troy, New York. But alas, there are &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_0"&gt;militant&lt;/span&gt; presences that have also chosen to occupy Troy, with devastating effects.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;What immediately comes to mind is the automobile/petroleum/insurance/medical/legal/war industry that occupies the very streets and parking garages of troy, that occupy the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_1"&gt;soundscape&lt;/span&gt; and the air we breath.  I think of the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_2"&gt;Hoosick&lt;/span&gt; street bridge overpass, a monstrous &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_3"&gt;military&lt;/span&gt; presence that some combination of huge automobile industry/government bodies dropped on a once thriving  neighborhood like a giant atom bomb, and now occupies that space, exuding It's lifeless larger than human scale ugliness and the violence of 100s of tons of metal and explosive combustion of gasoline every second speeding by at an &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_4"&gt;inhuman &lt;/span&gt;speed barely touching the landscape it races past (unless of course it's 'rush hour').  I think of butt-ugly housing projects and parking garages and cheaply slapped together &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_5"&gt;soulless&lt;/span&gt; buildings that now occupy the spaces and streets of troy in which i would like to enjoy living, in which once historic buildings were occupying that were built by people who made their fortunes in troy and chose to invest those fortunes in the town they admired and chose as their home.  I think of multinational &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_6"&gt;corporations&lt;/span&gt; which have at their disposal all the power of our nation's &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_7"&gt;military&lt;/span&gt; to occupy Troy and cities like it across the American landscape, who have sucked the life out of those cities in much the same way as have great empires sucked their colonies dry for profit.  And I think of the electronically amplified and disseminated &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_8"&gt;entertainment&lt;/span&gt; and communication complex that occupy our &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_9"&gt;soundscape&lt;/span&gt;, our conversations and our very minds, so that we no longer talk to each other face to face, no longer sing to each other breath to breath, or in fact sing WITH each other, no longer tell each other our stories, and ultimately no longer can think for ourselves.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;These are the forces against which I would like to RE-OCCUPY the city that I wish to call my home.  If such a re-occupation were to take place  locally in every city (with the ghastly Disneyland suburbs contracting once again to cities and farms), then the source of wealth of  the multinational banks and their collusion with our government would simply dry up.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;So, I don't want to occupy Wall Street, I want, along with my neighbors to once again fully occupy the city I call home, Troy.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-2901020292943435903?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/2901020292943435903/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=2901020292943435903' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2901020292943435903'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2901020292943435903'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/10/i-dont-want-to-occupy-wall-street-i.html' title='I Don&apos;t Want To Occupy Wall Street, I Want To Occupy Troy, NY, My Home Town!'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-3780588595094137857</id><published>2011-09-26T21:39:00.001-05:00</published><updated>2011-09-26T21:40:51.071-05:00</updated><title type='text'>The Problem With Sex - is that it is evolution's way of toying with us</title><content type='html'>The problem with sex is that is it evolution's way of TOYING with us. &lt;br /&gt;&lt;br /&gt;We are just momentary stopping points on life's grand 3.6billion year old journey of exhuberant and horrific creativity.  The urge to sex is THAT old, we really have no choice in the matter(and if we had complete choice, i'd wager that our branch of life would come to a dead end).  When we start juicing and desiring sex, it's our protoplasm's way of taking us along on its 3.6billion year old joyride and we really don't have much say in the matter.&lt;br /&gt;&lt;br /&gt;Through sex this ancient journey of life EXPERIMENTs with our children as would an artist, and like any artist, life ends up throwing away many possibilities in the trash heap. To create involves risk, the risk to produce nonsense, and indeed many of the gametes you and i produce are nonsense and not viable, and many conceptions turn out to be grotesque nonsense to be expelled before the mother even knows she is pregnant, and even after birth... there is no guarantee that our child won't have 3 arms or no trachea or only half a brain and live for only a week...&lt;br /&gt;&lt;br /&gt;And either way we eventually die.  Some, if they are lucky, peacefully, but for many it is harrowing for them and their loved ones.&lt;br /&gt;&lt;br /&gt;It is not an easy situation to take, that human suffering is the price we pay so that we can be part of this immensely creative show.  Let's face it: most people aren't terribly interested in creativity. &lt;br /&gt;&lt;br /&gt;Most certainly are not interested that Life has come up with over a million different colorful and surprising ways to say insect (and i'm not sure how many religious people would respond if it was pointed out to them: god likes beetles, 600,000 different kinds! or worms for that matter...  I suppose many might think it is Satan's work...)  Or even closer to home, that we share this creative show with dirty smelly noisy Gorillas, Chimpansees, Bonobos, Orangutans, and Gibbons (not to mention all those puzzling fossils suggesting that there were quite a variety of us human-like critters on earth some time ago), or even god forbid, gays and negroes...&lt;br /&gt;&lt;br /&gt;Anyway, when humanity collectively woke up to this reality, that their intensely experienced personal lives are encased in bodies that are seemingly made of featureless 'meat', When humans realized that they could dream of infinity, and imagine whole Kosmoses inside their heads and yet were imprisoned in bodies that would decay horribly and in the end limit them to finite lives - humanity rebelled and created the story of a grand drama of a benign eternal father (not mother, she would fear childbirth as possibly dangeous and anyway could threaten to abort...) who has a carefull plan for us, that we are not merely contingent whims of a grand evolutionary game, but that we are children of a father who desired to create precisely us and loves us and has put us here in these flesh prisons for...&lt;br /&gt;&lt;br /&gt;That part is confusing, the repulsion to being flesh was so intense that, well, perhaps like many children, we continued to wish to believe that our parents were perfect and that we were being punnished because it was our fault. As it is for young children, to have entertained the possibility that our 'parents' were not perfect, that there is no plan to it all... was too dizzying a prospect to take in.  When we first woke up to all this awareness, we had very little experience of what our powers were as humans, and probably had no confidence that we could stand on our own two feet in a world of exhuberant and chaotic creativity and destructivity.&lt;br /&gt;&lt;br /&gt;So most of us still choose to hide behind our imagined parents' aprons.  And the dominant Stories we created (most mythologies and religions) are our responses to this situation.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;It will be  a long road ahead of us.  The courage it takes to accept as our role to be, each one of us, in some sense alone, our own masters in this chaotic storm of creativity, that each of us is at the cutting edge of this creativity, responsible for playing our part in this vast game of evolution (which means that many will fail, sometimes miserably), is not easy.&lt;br /&gt;&lt;br /&gt;There is hope.  I would look at the stories of Buddhism, Judaism and science... but i suppose that will have to wait for the next installment!&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-3780588595094137857?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/3780588595094137857/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=3780588595094137857' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3780588595094137857'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3780588595094137857'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/09/problem-with-sex-is-that-it-is.html' title='The Problem With Sex - is that it is evolution&apos;s way of toying with us'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-1657598494572838868</id><published>2011-07-01T08:37:00.001-05:00</published><updated>2011-07-01T08:37:54.388-05:00</updated><title type='text'>Troy-On-Hudson Unfurles Her Sails</title><content type='html'>After loosing another two pounds of sweat at African dance class in downtown Troy(thank you Emily), I walked two blocks down State street to the Hudson river where an amazing  breeze and blaze of sunlight met me to dry the sweat off of me and the river calm and here comes a couple paddling kayaks upriver and the trees on the far shore and the seagulls wheeling above calling for the ocean and&lt;br /&gt;&lt;br /&gt;behind me are those riverside apartments that from the river's side have those quaint windows and brickworks, and we could be in Europe with cafe's down there by the river's setting sun and damn the parking garages and&lt;br /&gt;&lt;br /&gt;I walk up River Street to Monument Square(triangle) and the space is amazing and the care and craft supported by commerce that went into the details of those buildings, hoping the same care would go into the ones to be built in the site of the thankfully demolished 20th century version of city hall, but alas... and yet...&lt;br /&gt;&lt;br /&gt;walking up Broadway I find two new bars open and there ARE side walk cafe's where you can get a cheeseburger and sweet potato fries until 10pm and there's some life wakening here, and&lt;br /&gt;&lt;br /&gt;the sun still spilling down broadway and bronze Columbia, standing atop the pillar her skirts billowing in the breeze and I begin to imagine Troy at full capacity, sails unfurled catching the strength of one hundred thousand people with every shop open and all crafts and commerce and commotion and there would be more reasons to be in Troy and less reasons to drive away, more people would live in Troy and less need to drive cars here... there would be less cars,&lt;br /&gt;&lt;br /&gt;and more children running around the streets playing ball and hopscotch on the sidewalks and what did we use to play back in nyc?  skilsies!, and RPI blowing into a full grown university reaching her arms into downtown uprooting the suburban sprawl that has blighted 6th street, and between them parks grow over parking lots and playgrounds devour parking garages and more children and and more dogs running around and even philosophers and writers sitting at sidewalk cafes&lt;br /&gt;&lt;br /&gt;all fed by the river, boatloads of produce floating down the river from farms and more people chugging up the river from the whole world and Troy begins to draw its energy again from the river Hudson, the river that brings strength, the river that can take you places, the river that can bring calm, the river that can rise up again and take a whole city back down into the ocean where it all began.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-1657598494572838868?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/1657598494572838868/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=1657598494572838868' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1657598494572838868'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1657598494572838868'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/07/troy-on-hudson-unfurles-her-sails.html' title='Troy-On-Hudson Unfurles Her Sails'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-4873547980060440088</id><published>2011-06-18T09:33:00.002-05:00</published><updated>2011-06-18T09:35:55.823-05:00</updated><title type='text'>Discussion on Jesus as Sacrifice For Our Original Sin</title><content type='html'>so Mirrizin says:&lt;br /&gt;&lt;br /&gt;Nachum Braverman, a Jewish Rabbi, describes the process&lt;br /&gt;&lt;br /&gt;"You rest your hands on its head and you confess the mistake you made. Then you slaughter the cow. It's butchered in front of you. The blood is poured on the altar. The fat is put on the altar to burn. How do you feel? (Don't say disgusted.) I'll tell you how you feel. You feel overwhelmed with emotion, jarred by the confrontation you've just had with death, and grateful to be alive. You've had a catharsis. The cow on the altar was a vicarious offering of yourself"&lt;br /&gt;&lt;br /&gt;...&lt;br /&gt;&lt;br /&gt;Christ took the guilt with him. The point of a Jewish sacrifice, I think as I've recently read (check with blackskimmer, perhaps? or davidmordichai? Prefect?) would be not to appease God by giving something away, but to project your guilt onto a living thing and then symbolically slaughter it to remind yourself of what you had done, and then to shock yourself back onto the right path.&lt;br /&gt;&lt;br /&gt;Jesus wasn't killed because God likes killing. Jesus was killed because he was trying to get his (God's) point across. Christ took it all with him so that we could see the way to go.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;and I said:&lt;br /&gt;jesus was all about shock! his message: get out of the slumber of your everyday family life, political life, religious life and WAKE UP, drop everything and follow me and examine your life.&lt;br /&gt;&lt;br /&gt;were's my thoughts on why god committed seppuku?&lt;br /&gt;&lt;br /&gt;why jesus died for our sins &amp;lt; blackskimmer &amp;gt; 05/25 13:23:37 &lt;br /&gt;&lt;br /&gt;the formulation i came up with back when i lived some christianity was this: &lt;br /&gt;&lt;br /&gt;life for humans in this universe inherently involves sinning. no way to avoid it, not hard thought nor technology. there are always mysteriously unavoidable dilemmas. i.e. abortion, saving lives, hell even just to die at your appointed time seems like a sin against such a splendid being.... that's how life is for organisms as complex as us. Sometimes we even blame ourselves for our own deaths.  Certainly this is a biblical take on the situation, that human failing is responsible for the introduction of death in the world.&lt;br /&gt;&lt;br /&gt;Even birth, to conceive a child, an act of love, of creativity, of hope, creates the possibility of danger, to the mother and the child.&lt;br /&gt;&lt;br /&gt;so what do you do? recall Arjuna's dilemma in the baghavad gita. he was a warrior in charge of an army in a major battle. he was up on the hill watching the two sides and started to imagine all the suffering and destruction that would occur if he sent his side into battle. also all the suffering and destruction that would occur if he didn't fight and the other army attacked... &lt;br /&gt;&lt;br /&gt;so he froze! it took the whole book for krishna to convince him there was no way possible for finite humans to understand which way to act brings less suffering in many cases, but we cant just crawl under a rock and NOT enter the fray. &lt;br /&gt;&lt;br /&gt;what i take jesus dying on the cross to mean is that our life involves sinning, that's a given, not quite we 'inheritted it from an act of adam' but that's just how it is to be human, even to be interesting.&lt;br /&gt;&lt;br /&gt;We are not perfect robots, but creative beings, and beings born into the act of creative evolution.  all creation involves risk, involves invention of ideas and choosing between them.  to be able to take part of this creative act of evolution requires that we be vulnerable.  to congenital illnesses, to cancers.  to death. we find this horrifying, but the alternative is to be perfect, eternally fixed.&lt;br /&gt;&lt;br /&gt;but who can love a perfect robot?  we love each other because we can identify with the other's frailties.&lt;br /&gt;&lt;br /&gt;i figured there are two levels of responsibility? if you think YOU are responsible for getting yourself into one of these impossible dilemmas where either choice is a sin, if you think you are responsible for your own death, then you are in anguish and freeze. and even if you freeze something bad will happen anyway because you didn't act... &lt;br /&gt;&lt;br /&gt;the message of jesus dying is: 'you are NOT responsible for being in that situation, it is the common human condition. I, God, put you there by creating you that way. i'm the only one who could forgive you for being human! so now go and choose one of the choices that you think is best, and act on it. and even if you think it is not the perfect choice, go ahead and bumble through it anyway (no perfect choice may be possible) TAKE RESPONSIBILITY for that choice and live with the consequences, but don't be burdened by thinking you put yourself into the position to make that choice.'&lt;br /&gt;&lt;br /&gt;and then we are called to emulate god in his forgiveness, to forgive each other for not being perfect.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-4873547980060440088?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/4873547980060440088/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=4873547980060440088' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4873547980060440088'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4873547980060440088'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/06/discussion-on-jesus-as-sacrifice-for.html' title='Discussion on Jesus as Sacrifice For Our Original Sin'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-422695958808383292</id><published>2011-06-18T08:01:00.001-05:00</published><updated>2011-06-18T08:03:27.424-05:00</updated><title type='text'>Hitting Your Thumb While Trying To Hammer In Your Life</title><content type='html'>expect cursing &lt;br /&gt;when you attempt to dive &lt;br /&gt;into the tumultuous waters &lt;br /&gt;of religion.&lt;br /&gt;&lt;br /&gt;don't you curse &lt;br /&gt;when trying to hammer in a nail &lt;br /&gt;and you hit your thumb instead?&lt;br /&gt;&lt;br /&gt;how much deeper the pain must be&lt;br /&gt;when trying to drive in straight&lt;br /&gt;a whole human life&lt;br /&gt;and miss...&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-422695958808383292?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/422695958808383292/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=422695958808383292' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/422695958808383292'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/422695958808383292'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/06/hitting-your-thumb-while-trying-to.html' title='Hitting Your Thumb While Trying To Hammer In Your Life'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-5108336611760409215</id><published>2011-06-17T09:06:00.004-05:00</published><updated>2011-06-18T09:31:34.768-05:00</updated><title type='text'>How An Animal Grows From a Single Egg Cell: It's Like a City Growing From One Colonist Stranded On a Lush Tropical Island</title><content type='html'>An animal is a society of tiny single celled organisms, that is growing by way of these living cells giving birth to more and more cells and informing each other and rearranging each other.&lt;br /&gt;&lt;br /&gt;To what kind of human venture is it most like?  The founding of a city?  So pretend one person washes up on a beach a lush tropical island beach and for the hell of it, pretend people are unisex and reproduce by splitting in half.  (quite odd, eh?)  so this person eats all the cocounts and mangos and gets fat and splits. At first the fellow is doing everything, finding food, chasing away monkeys, building fire, foraging for supplies, building shelter...  then the twins split and they split...&lt;br /&gt;&lt;br /&gt;Now at first they are identical twins.  But soon the colonists begin specializing in different tasks, and the more each twin specializes and perfects his craft he interacts differently with his other twins, and forces them to change their habits too.  now, all the while they are still splitting so guilds form and specialization within guilds happens.  A village starts to form, with twins building huts around themselves and some roads to make  it easy to move resources and materials around.  And then some guilds start specializing on building and roadmaking...  Since they are all clones of each other, they form a very closeknit and well coordinated society.&lt;br /&gt;&lt;br /&gt;As the village grows, more specialization happens, different groups start forcing each other to reorganize, rerouting roads etc..  More structure forms, more organization, more complex interactions, materials are processed in more elaborate chains of production.  As storms come, seasons change, land gets used up, visitors come, possible invaders...  the village begins behaving in more complex ways, forms complex governments, diplomatic missions, armies, traders, politicians...&lt;br /&gt;&lt;br /&gt;In essence, the city is built from within by its 'cells'.  That's how animals form.  Now to make our city more like an animal, imagine the city structure build like a giant robot like one of those transformer toys. Instead of being built on the ground, the whole structure is being built in 3 dimensions, the whole city structure is flexible capable of walking about, or even flying.  A giant honeybee robot!&lt;br /&gt;&lt;br /&gt;To get closer to being like an organism, lets add one more layer of complexity. Most of the scaffolding and mechanisms of an animal are made of the cells themselves, (with some nonliving bone and fiber built in for strength...).  Now, a honeybee is a million cells.  That's how many people in a fairly big human city, say just manhattan.  The reason that the organs and tissues of an animal are so much more flexible and responsive than human city structures is that the animal organs and tissues are build out of the living cells themselves. So all the structures are dynamic, responsive to each other.&lt;br /&gt;&lt;br /&gt;So imagine  the roads are lined with these ... ok, so imagine these colonists as not QUITE humans, a little dumber, a little more able to settle for performing very simple roles.  As indeed some animals are, like oysters, and various simplified parasites...  which start off as flexible swimming sensing larvae and then settle down to become basically, sessile, eating tubes producing eggs.&lt;br /&gt;&lt;br /&gt;So imagine these colonists, making buildings out of themselsves, holding onto each other.  Imagine the elevators are groups of people some holding each other making a basket for other people to ride in while the others do the climbing up and down.  Some are the windows opening and closing because the 'people' that form them can sense the environment and respond the the people inside.  The scaffolding is people holding onto each other so it can respond to changing loads , the building can shift over if it needs to. Cars and busses are simply bunches of people holding onto each other walking with  their legs   letting riders sit on them, some of them use their eyes to see, steer, communicate with other cars, some collect food and distribute it to the other 'people' that make up the car.&lt;br /&gt;&lt;br /&gt;So all the structures and machines in the city are alive, are made of 'people' that can communicate with each other, allowing the structures to respond to each other and even think how to respond.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;So that's what animals are.  Cities made mostly out of societies of simpler single celled organisms.  You and I are stupendous cities made of a trillion cells.  that's like one hundred thousand new york cities full of people.  One step in realizing that life is not a shear magical mystery is realizing the numbers involved, the complexity capable of those numbers.&lt;br /&gt;&lt;br /&gt;If you wonder how a brain can think, realize that it is made of a hundred billion neurons.  A society of one hundred billion simple critters capable of making simple decisions, inventing tiny snippets of ideas, memorizing a word or two at a time, all having conversations with each other.  Typical neurons are connected to a thousand others at a time, and synthesizes information from all of them while then sending out signals to hundreds of others in the network.  This society takes over 30 generations to form (typically a cell takes about a day to divide into two cells)  Over the time of these 30 generations the cells form all kinds of social bonds and rearrangements and habits of communication...&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;And, if these cells that build the organism-city out of themselves, are themselves organisms too, simpler ones, what are THEY made of?  If they are like animals, do THEY have organs and parts?  Are THEY cities of even SIMPLER sub-cellular organisms?&lt;br /&gt;&lt;br /&gt;Kind of...This living world is made of quite a few levels nested in deeper and deeper...  Very strange universe!  In the next chapter we will explore the world of those subcellular parts - molecules, what are they and  What can they do?&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-5108336611760409215?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/5108336611760409215/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=5108336611760409215' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5108336611760409215'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5108336611760409215'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/06/how-animal-grows-from-single-egg-cell.html' title='How An Animal Grows From a Single Egg Cell: It&apos;s Like a City Growing From One Colonist Stranded On a Lush Tropical Island'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-8413855286545037053</id><published>2011-05-03T10:10:00.005-05:00</published><updated>2011-05-15T08:18:26.116-05:00</updated><title type='text'>I Find The River Restful Again</title><content type='html'>The Hudson river is calm now,&lt;br /&gt;before me.&lt;br /&gt;by Green Island bridge&lt;br /&gt;at the feet of Troy.&lt;br /&gt;I imagine its green soup seeping from sundrenched algaes&lt;br /&gt;that grow over pebbles in the Adirondack brooks.&lt;br /&gt;The sandpipers stepping, plucking grubs.&lt;br /&gt;A primeval place i could have made my home&lt;br /&gt;to wake to the sounds of the speachless birds.&lt;br /&gt;&lt;br /&gt;The river is resting.&lt;br /&gt;after its busy weekend, when&lt;br /&gt;on my way to the bus this past friday&lt;br /&gt;the river surprised me.&lt;br /&gt;Not aimless and ambling,&lt;br /&gt;bland muddy,&lt;br /&gt;but an swirling burls of green waters intent on passing me&lt;br /&gt;faster than i had ever seen it,&lt;br /&gt;toting jostling tree trunks and foam and random stuff&lt;br /&gt;startlingly high.&lt;br /&gt;I could almost reach below its cement berm&lt;br /&gt;and touch it&lt;br /&gt;where it's usually five feet below,&lt;br /&gt;unreachable.&lt;br /&gt;&lt;br /&gt;The tide was up .&lt;br /&gt;And i remembered seeing the sliver moon&lt;br /&gt;inching towards dawn a few mornings ago.&lt;br /&gt;The rebirthing jesus moon&lt;br /&gt;who called people to churches&lt;br /&gt;emptying the streets of troy&lt;br /&gt;last easter weekend.&lt;br /&gt;Then to slipp behind the sun for rebirth.&lt;br /&gt;Sun, the far seething furnace giant&lt;br /&gt;birthing the elements&lt;br /&gt;and the moon our brother, closer&lt;br /&gt;ball of silent rock finished with its violent geology,&lt;br /&gt;together shoulder to shoulder pulling&lt;br /&gt;the seawaters with their tide ropes of tugging gravities&lt;br /&gt;towards the hot summer noon&lt;br /&gt;calling the river to flood banks, and hide tree roots.&lt;br /&gt;&lt;br /&gt;Now the river  washes me&lt;br /&gt;from a weekend of rushing and conflicted interests&lt;br /&gt;of indecisions&lt;br /&gt;of filling my life with pencilled in commitments&lt;br /&gt;pulled by the tides that distract,&lt;br /&gt;from the rest,&lt;br /&gt;the nourishment&lt;br /&gt;of the silence of earth of foundling brooks&lt;br /&gt;at Lake Tear of the Clouds&lt;br /&gt;silent origin of the hudson&lt;br /&gt;nested in trees far from the industry of men.&lt;br /&gt;&lt;br /&gt;Now I dream in the green deeps of the ocean dreaming river&lt;br /&gt;before the human tides of this city pull me apart&lt;br /&gt;again.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-8413855286545037053?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/8413855286545037053/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=8413855286545037053' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8413855286545037053'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8413855286545037053'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/05/hudson-is-calm-now.html' title='I Find The River Restful Again'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-4273581423393090355</id><published>2011-05-03T08:15:00.001-05:00</published><updated>2011-05-03T08:15:46.984-05:00</updated><title type='text'>doan wan no chickens here</title><content type='html'>just what were the arguments against chickens anyway?  that they spread diseases like inner city blight?  that they create a racket like gas exploding boombox pumping childflesh crushing automobiles ?  that they'll get loose and get in people's ways like cop cars screaming around corners and tripping over curbs?  or is it that their eggs will put stewart's pimps of saddam hussain juice and oversalted potato chips and sad lottery tickets stealing from the poor and give to the rich out of business?&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-4273581423393090355?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/4273581423393090355/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=4273581423393090355' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4273581423393090355'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4273581423393090355'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/05/doan-wan-no-chickens-here.html' title='doan wan no chickens here'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-6384509379883402372</id><published>2011-05-01T10:11:00.006-05:00</published><updated>2011-05-15T08:20:23.968-05:00</updated><title type='text'>Ancestors of the Summer Meadow</title><content type='html'>(Writing exercise after Richard Eberhart's 'The Groundhog'. First attempt.  Original text after mine)&lt;br /&gt;&lt;br /&gt;One morning in July when i was a lad,&lt;br /&gt;I visited that sweltering sundrenched meadow&lt;br /&gt;strewn with flowers and freckled with butterflies,&lt;br /&gt;I found a dead possum.&lt;br /&gt;resting on a bare patch of earth&lt;br /&gt;baking in the sun&lt;br /&gt;his possum shape began its terrible transformations.&lt;br /&gt;The full moist meadow breathed&lt;br /&gt;earth's maw ready to consume him.&lt;br /&gt;His stench struck my equilibrium.&lt;br /&gt;My skin trembled and&lt;br /&gt;my thoughts tumbled off reality.&lt;br /&gt;&lt;br /&gt;Nevertheless i had to explore&lt;br /&gt;those maggots' seething maelstrom's orgy&lt;br /&gt;diving into his death's dark  dreaming.&lt;br /&gt;&lt;br /&gt;With revulsion, awe, then sadness&lt;br /&gt;i touched him with a tentative stick.&lt;br /&gt;My stomach curdled with sour thoughts.&lt;br /&gt;The clouds like clotted cream&lt;br /&gt;made sick the welcoming sun.&lt;br /&gt;Life's flame in me drowned.&lt;br /&gt;I stood there dumb&lt;br /&gt;transfixed by this thing,&lt;br /&gt;then sat by his side&lt;br /&gt;nausea settling&lt;br /&gt;and strained to hear the story.&lt;br /&gt;&lt;br /&gt;I visited there again&lt;br /&gt;in that autumn's clarifying call.&lt;br /&gt;The possum's fat had melted into earth.&lt;br /&gt;Only withered skin stretched taught on bones remained&lt;br /&gt;I left my summer memories there&lt;br /&gt;wanderings of childhood&lt;br /&gt;packed my bags&lt;br /&gt;and set off for college&lt;br /&gt;&lt;br /&gt;One more year the blanketing snows fell&lt;br /&gt;And sweet spring's nectars rained to cleanse the earth.&lt;br /&gt;Returning, I found only his frightful teeth&lt;br /&gt;grinning to the summer sun.&lt;br /&gt;His last laugh to life.&lt;br /&gt;I knelt to breath the moist tang of  earth&lt;br /&gt;and tried to listen to the meadow's tremulous singing&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Returning home after many autumns passed&lt;br /&gt;that possum's drama left no trace.&lt;br /&gt;The meadow danced its timeless tunes.&lt;br /&gt;I sighed my memories of forgotten friends&lt;br /&gt;and called to the ancestors of that place:&lt;br /&gt;Eohippus, saber tooth,&lt;br /&gt;red skinned cheiftains with their feathered dress,&lt;br /&gt;welcomed me to rest in that earthen bed.&lt;br /&gt;&lt;br /&gt;1May2011 busride to nyc&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;The Groundhog&lt;br /&gt;Richard Eberhart&lt;br /&gt;&lt;br /&gt;In June, amid the golden fields,&lt;br /&gt;I saw a groundhog lying dead.&lt;br /&gt;Dead lay he; my senses shook,&lt;br /&gt;And mind outshot  our naked frailty.&lt;br /&gt;There lowly in the vigorous summer&lt;br /&gt;His form began its senseless change,&lt;br /&gt;And made my senses waver dim&lt;br /&gt;Seeing nature ferocious in him.&lt;br /&gt;Inspecting close maggots' might&lt;br /&gt;And seething cauldron of his being,&lt;br /&gt;Half with loathing, half with a strange love,&lt;br /&gt;I poked him with an angry stick.&lt;br /&gt;The fever arose, became a flame&lt;br /&gt;And Vigour circumscribed the skies,&lt;br /&gt;Immense energy in the sun,                 &lt;br /&gt;And through my frame a sunless trembling.&lt;br /&gt;My stick had done nor good nor harm.&lt;br /&gt;Then stood I silent in the day&lt;br /&gt;Watching the object, as before;&lt;br /&gt;And kept my reverence for knowledge      &lt;br /&gt;Trying for control, to be still,&lt;br /&gt;To quell the passion of the blood;&lt;br /&gt;Until I had bent down on my knees&lt;br /&gt;Praying for joy in the sight of decay.&lt;br /&gt;And so I left; and I returned                   &lt;br /&gt;In Autumn strict of eye, to see&lt;br /&gt;The sap gone out of the groundhog,&lt;br /&gt;But the bony sodden hulk remained&lt;br /&gt;But the year had lost its meaning,&lt;br /&gt;And in intellectual chains                                               &lt;br /&gt;I lost both love and loathing,&lt;br /&gt;Mured up in the wall of wisdom.&lt;br /&gt;Another summer took the fields again&lt;br /&gt;Massive and burning, full of life,&lt;br /&gt;But when I chanced upon the spot          &lt;br /&gt;There was only a little hair left,&lt;br /&gt;And bones bleaching in the sunlight&lt;br /&gt;Beautiful as architecture;&lt;br /&gt;I watched them like a geometer,&lt;br /&gt;And cut a walking stick from a birch.&lt;br /&gt;It has been three years, now.&lt;br /&gt;There is no sign of the groundhog.&lt;br /&gt;I stood there in the whirling summer,&lt;br /&gt;My hand capped a withered heart,&lt;br /&gt;And thought of China and of Greece,       &lt;br /&gt;Of Alexander in his tent;&lt;br /&gt;Of Montaigne in his tower,&lt;br /&gt;Of Saint Theresa in her wild lament.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-6384509379883402372?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/6384509379883402372/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=6384509379883402372' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/6384509379883402372'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/6384509379883402372'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/05/ancestors-of-summer-meadow.html' title='Ancestors of the Summer Meadow'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-2978531310051526322</id><published>2011-04-21T21:21:00.004-05:00</published><updated>2011-04-21T21:56:42.110-05:00</updated><title type='text'>Life is a Dancing Swarm of Molecular Robot Parts</title><content type='html'>[This is the introduction to chapters III, IV and V out of 12 of the Complexity Lab Manual.  It is preceded by a chapter and labs on natural history, and then a chapter on how to build robots to try to mimic life, from the transistors on up, giving us our first hint of the complexity involved. More concrete examples will be inserted in the future.]&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Unlike our machinery, life builds itself from the inside out.  Tiny robots that build each other and crawl around each other and can make chemical transformation from air to plant to animal flesh.  That’s a lot to take in.&lt;br /&gt;&lt;br /&gt;Just as we saw how to build robots hierarchically up from simple transistors and motors and pulleys and how to build their behavior hierarchically up from subroutines of subroutines... so does life:&lt;br /&gt;&lt;br /&gt;First: our bodies are societies of a trillion amoebas.  We start off as a colony of the society of amoebas that is our mother. A group of them settles in her ovary and one of them gives birth.. Well they give birth by splitting in half..  Anyway this colony population grows and as it does the members shape each other, move around each other, build ties, lay down bony scaffolding and fibrous scaffolding to hold themselves all in place.  They set up dances with each other, hundreds dancing a heart some lungs, contracting muscles and the conversation that is the brain...&lt;br /&gt;&lt;br /&gt;All the while the mother is shipping them food that they grow on and removing their garbage... eventually they are ready to leave as an independent being.&lt;br /&gt;&lt;br /&gt;We can actually watch a critter like a snail or roundworm do this under a microscope and make a movie of it.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;That these amoeba can do all this... well are they just like people themselves like the mirrors within mirrors?  Nearly, but only one cell each.  We can watch one of these moving pinpoints  in a drop of pond water under a microscope and see that it is in fact a microscopic animal capable of many of the basic behavior of us big animals: swimming, crawling, searching, thinking, hunting food, growing, seeking mates, reproducing, dying.  these single cells are the most basic level of organization of life.&lt;br /&gt;&lt;br /&gt;Put a strand of algae in a jar of water and air and it grows more of itselves out of thin air! this is chemistry, and what are the parts inside?  For we can see stuff streaming around in these little protozoans.  How do algae grow themselves out of air water and stuff that leaks out of glass?  How does life transform rock and air and water into life?&lt;br /&gt;&lt;br /&gt;Some clues: we can grind up these simple critters and do paper chromatography on them you see that the stains soaking upwards on the paper separate into distinct blobs  with craft, you can get a hundred or more blobs to separate. Are they distinct kinds of parts the critters are made of?&lt;br /&gt;&lt;br /&gt;Chemistry is the most exciting scientific discovery for us living thinking beings.  What is it?&lt;br /&gt;&lt;br /&gt;The first discovery is that even though the world seems to be made out of an infinite blended variety of colors tastes and textures and smells, in fact we can chemically reduce all these substances into a FEW distinct types.  Visit a museum and see a 1000 different mineral forms and colors and textures.  From this we can isolate a toolbox of merely about 50 elemental substances that can't be chemically broken down any further.  in fact 100s of different minerals, and indeed 99.99% of what's around us can be made solely from the dozen or so most common elemental substances.  This is remarkable.  These are:&lt;br /&gt;&lt;br /&gt;The metallic elementals: Sodium, makes the sea salty.  Potassium, used by the batteries in neurons. Calcium, makes bones seashells, limestone. Magnesium, makes chlorophyll green.  Iron, the catalyst that can among other things, carry oxygen in our blood from lungs to muscles.&lt;br /&gt;&lt;br /&gt;The semiconductors: Aluminum, together with Silicon, make the scaffolding that holds the metals together to make up 95% of all the rocks around us, in fact, all the earth.&lt;br /&gt;&lt;br /&gt;The nonmetals: Carbon, the stuff in air that becomes the backbones of wood and flesh.  Oxygen, which connects all these and dissolves them in water and burns.  Hydrogen, that helps oxygen make water.  Nitrogen, the stuff in air that compliments the Oxygen in our chemistry.  Phosphorus, storing the energy currency that all life uses, and backbone to our genetic blueprints.  Sulfur, the connector that holds iron catalysts in our enzymes to metabolize our food.  And Chlorine, Sodium's partner in dissolving in seawater.&lt;br /&gt;&lt;br /&gt;And this is the first hint at the essentially digital, discrete nature of the stuff of our world.&lt;br /&gt;&lt;br /&gt;The next clue is that we can react simply carbon, hydrogen and oxygen together and get strikingly different compound substances, organic compounds, each with distinct properties.  These different substances can be separated from each other and we can burn each sample back up to separate out the elements and see that each compound contains the same PROPORTIONS off each of these three elementals.&lt;br /&gt;&lt;br /&gt;Something fishy is going on.  through careful experiments and reasoning chemists guessed that these elemental substances came in discrete particles they called atoms and that the different compounds had different properties because the same atoms arranged themselves together in different geometries, either in straight chains or branched ones or rings or even more complicated. Many of the properties of stuff, like color, taste, hardness... come from the way discrete parts arrange themselves in different geometric relationships.&lt;br /&gt;&lt;br /&gt;Finally at the beginning of the 20th century we discovered that stuff was in fact made of many discrete parts that we call atoms.  The shock is how small they are and how many it takes to make up a blob of stuff.  If we imagine one of our amoeba or paramecium with its cilia and vacuoles and all it's behaviors as a robot made of parts, how many parts can there be in there? You can hold in the palm of your hand 600,000, 000,000,000, 000,000,000 molecules of water.  This is the Avogadro’s number that you learned in freshman chemistry.  It is a painstaking experiment to measure this number.  I think that it is one of our most radical scientific discoveries.&lt;br /&gt;&lt;br /&gt;Nearly a million billion billion.  even I don't know how to imagine that number, so we go hierarchical again: a glass of water is 100 cubes of water the size of sugar cubes, so each cube (cubic centimeter) has (divide the big number by a 100) 10,000, billion billion molecules.  Now we can break each of those cubes up into 10X10X10 tiny cubes (draw all those cross hairs on the cube) and get 1000 tiny sandgrain cubes.  So each of those has 100, billion billion molecules.  now, how big are those tiny paramecium? We watched them in our microscope, they are about a 10th of the length of the side of a sandgrain cube, so we draw crosshairs again and 10X10X10, divide by a thousand again: 100, million billion molecules in the paramecium.&lt;br /&gt;&lt;br /&gt;Now if we grind up paramecium and separate out their chemicals like we did with the paper chromatography we find out that some of the substances are a dozen times as heavy as water molecules. Those are sugars and amino acids, and fats.  And there are substances that are 100s of times as heavy as those and these are proteins.  So there can be 10million billion small molecules and 100thousand billion proteins in the paramecium.  Now we are getting somewhere.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;To help you visualize this stupendous number, let's do this guided visualization: imagine yourself standing in front of a large apartment building in New York City.  a window is maybe 10X20 bricks (200) there are 20 X 20 stories worth of windows on the face of the building (so 400 windows times 200 bricks =80,000 bricks in one face) now just for the hell of it, making a gross overestimate in the number of bricks, imagine the building is solid bricks, so the building is 200 bricks deep, so the solid building would be made of 200X80,000 bricks or 16,000,000.  Now there are 5X10 buildings on that block, so that’s 50X and we get 1000,000,000 bricks per block.  Manhattan is about 10blocks wide by 200 blocks long so that's 2000 X or 2thousand billion bricks in Manhattan.  For the hell of it lets think of 5 boroughs (nowhere near as densely built as midtown Manhattan..) and we have 10thousand billion bricks in nyc.&lt;br /&gt;&lt;br /&gt;That's how many of these proteins there are in that tiny dot we watched in the pond water crawling around.&lt;br /&gt;&lt;br /&gt;Ok, what are these proteins?  Are they like bricks?  Well, to cut to the chase, in the past century we’ve actually learned to SEE these proteins, with electron microscopes and x-ray diffraction, to watch them MOVE and change shape with fluorescent microscopy.  So here is the story:&lt;br /&gt;&lt;br /&gt;What ARE these molecules?  After a 150 years of experimenting with them, here's what you can discover in an organic chemistry class.  They can sense their surroundings, sense each other, sense essential qualities in each other like size and shape and electrical charge.. They can respond to each other in simple ways.  They can attach to each other in specific shapes and replace parts of each other and come apart in specific ways and recombine.  They are like parts of machines that don't need mechanics to put them together, because they are in constant motion, jostling, sensing each snapping together by their own internal rules.  (kind of like the way each of us is a society of amoebas that sense each other and build with each other their arrangements.  However, It is important to note though,  that the molecules are MUCH simpler than amoebas, and are not alive, they don't eat and grow and can't perform trial and error chains of thinking).  Molecules are springy and vibrate, and wiggle.  They can absorb and emit specific amounts of energy that we sense as different colors and as heat.  They are kind of fuzzy without discrete boundaries and this is why they can sense each other and attach and come apart.&lt;br /&gt;&lt;br /&gt;Going in deeper, we've discovered that it's the dancing of electrons that shape and give dynamics to molecules. These electrons are at the same time discrete dots of charge and also vibrating waves (don't try to wrap your heads around this one, this is the central mystery of quantum mechanics, which after a 100 years since its discovery still  puzzles the discoverers of this new kind of physics).  This is what makes molecules fuzzy and sensitive and springy and interact with energy and light.  It is what makes them utterly different than our clunky inert machine parts.&lt;br /&gt;&lt;br /&gt;In a way, these electrons are like the transistors we started with some chapters ago, and the molecules are like the logic gates that we built up, layer upon layer to make our complicated 'thinking' computers.  Except, that while our transistors and computer chips could process information, they could not move around and recombine with each other.  But molecules CAN do these things.  So in essence they are tiny pieces of computer/robots.  And in fact the larger ones, the proteins made of smaller parts, the amino acids, DO act as small computers and small robots.&lt;br /&gt;&lt;br /&gt;But they are very different than the computers and robots that we design.  we use to much one pointed consciousness in our craft, to much thinking about one thing at a time and building one machine at a time from the outside. The protein robots think more like swarms of honeybees or ants or termites and get together in crowds and cooperatively construct machines.  And the processes they perform is like  a whole bunch of subroutines working on each other simultaneously instead of the way ours do it, executing one at a time.&lt;br /&gt;&lt;br /&gt;And of course these protein robots, being so close to the basic level of molecules CAN build each other out of foodstuff, the water air and glass that our algae cells grew themselves from.  Because they are made out of  proteins.&lt;br /&gt;&lt;br /&gt;So here is what life is: at the basic level a living creature is a swarm of 100thousand billion cooperatively coordinating tiny robots, of about 1000 different kinds, constantly interacting, building huge structures out of each other, taking these structures apart, putting them back together, taking each other apart and building new ones depending on the needs of the swarm... this happens incredibly fast: proteins change shape and jostle around millions of times a second.&lt;br /&gt;&lt;br /&gt;I want you to meditate for a bit on where we have reached in our journey inward... the levels within levels of mechanisms made out of each other.&lt;br /&gt;&lt;br /&gt;Again, imagine yourself taking a few days to wander around New York City, and imagine each of those bricks are one of the thousand different kinds of protein robots in a paramecium, each taking the place of one of these bricks, all swirling around interacting with each other building static and dynamic structures out of each other on the time scales of seconds, minutes, hours.  You can watch them reproduce an ENTIRE CITY in a matter of DAYS.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;[This is followed immediately by a chapter on how simple energy flow organizes fluids, chemistry into stable, creative dynamic patterns.  How life is animated.  And then a chapter of math and computer games that show how millions of simple interacting parts can take these dynamic patterns and elaborate them into surprising complexity.&lt;br /&gt;&lt;br /&gt;Eventually we survey what we've discovered so far about the chemistry at the origins of life itself. ]&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-2978531310051526322?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/2978531310051526322/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=2978531310051526322' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2978531310051526322'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2978531310051526322'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/04/life-is-dancing-swarm-of-molecular.html' title='Life is a Dancing Swarm of Molecular Robot Parts'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-2583286201042708286</id><published>2011-04-12T15:58:00.002-05:00</published><updated>2011-04-12T16:07:47.083-05:00</updated><title type='text'>On Hebrew Prayer: Organizing Principles and Surprise</title><content type='html'>&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_0"&gt;barukh&lt;/span&gt;' &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_1"&gt;ata&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_2"&gt;yhvh&lt;/span&gt; '&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_3"&gt;eloheinu&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_4"&gt;melekh&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_5"&gt;ha'olam&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;"&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_6"&gt;barukh&lt;/span&gt; '&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_7"&gt;ata&lt;/span&gt;" means  blessed are you.  I bless you (well hell, i don't really understand this     ENGLISH word 'to bless' we don't really use it every day do we?), i am thankful for you i am in awe of you.  You?  &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_8"&gt;yhvh&lt;/span&gt; (the 4 letters representing the holy  name in &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_9"&gt;Tanakh&lt;/span&gt; (bible) that traditional &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_10"&gt;Judaism&lt;/span&gt; does not pronounce, though in the bible it certainly seems to function as a &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_11"&gt;pronounceable&lt;/span&gt; personal name) is presence/miracles (which is what i call that state i am in when i am intensely aware of the miraculousness of existence itself.  It is not a state of duality, ME being present TO miracles outside me, but a state of awareness that breaks down barriers between subject/object sensation/action)  always available if i cut the tense &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_12"&gt;headchatter&lt;/span&gt; worry about time and just be in this moment that is not yet death as long as i am present.&lt;br /&gt;&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_13"&gt;yhvh&lt;/span&gt;, presence, as close as breath not just something i feel, but feeling itself, the act, not something outside of me, no duality.&lt;br /&gt;&lt;br /&gt;a personal particular name of a presence who came to my people?  I suppose whenever one of us has this kind of experience it is experienced as &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_14"&gt;intensely&lt;/span&gt; particular.&lt;br /&gt;&lt;br /&gt;Now in traditional Jewish prayer we say '&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_15"&gt;barukh&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_16"&gt;ata&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_17"&gt;adonoi&lt;/span&gt;' so as to avoid pronouncing the name meaning blessed are you, our lord. (Some say &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_18"&gt;barukh&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_19"&gt;ata&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_20"&gt;hashem&lt;/span&gt;, blessed is the name) Not Lord, Sir. I am not a slave to presence/miracles, presence/miracles is not a big man who has made it in the world, who is more capable than me, who has accumulated more than me. &lt;br /&gt;&lt;br /&gt;it is not lord/slave, it is partnership.  miracles cannot create without the stable beings we are who can catch energy flow, choosing some miracles and letting others go.&lt;br /&gt;&lt;br /&gt;Certainly not a being at all, yet distinctive in some way?  definitely presence, that i can remember, name if i want, but no name is the real name.  presence/miracles is not outside of me, i can give presence/miracles no pronoun, i can't &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_21"&gt;even&lt;/span&gt; talk ABOUT presence/miracles, only each time I want to mention presence/miracles I must BE in presence/miracles.  Very similar to 'i will be who i will be'  'whoever i want to be, you can't predict', 'i am the spark who wakes you out of staleness.'&lt;br /&gt;&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_22"&gt;'Eloheinu&lt;/span&gt; (our god, '&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_23"&gt;elohim&lt;/span&gt; with the 'our' ending. 'Elohim looks like the plural of El also a word found in &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_24"&gt;Tanakh&lt;/span&gt; to represent various middle eastern gods, but is not considered in the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_25"&gt;Jewish&lt;/span&gt; tradition to be plural.) However a friend suggested to me that the form of the word is similar to words like (water) and &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_26"&gt;khayim&lt;/span&gt; (life), so we can take it as an all pervading force that you cant split up into &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_27"&gt;pieces&lt;/span&gt;,  the all pervading not-stuff of the universe, the patterns that make the universe, the physics, the mathematics.  perhaps we can coin a new word like '&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_28"&gt;elohayim&lt;/span&gt;.&lt;br /&gt;&lt;br /&gt;So if &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_29"&gt;Elohayim&lt;/span&gt; is the physics the predictable, then &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_30"&gt;yhvh&lt;/span&gt; is the unpredictable, the singularity, the quantum fluctuation that brings the potential of physics into being a universe.&lt;br /&gt;&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_31"&gt;Melekh&lt;/span&gt; (king)?  what do &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_32"&gt;Malakhim&lt;/span&gt; do?  rule?  push people around?  coerce people?  no, they are charismatic centers around which people organize THEMSELVES.  &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_33"&gt;Malkhut&lt;/span&gt; is the organizing principles themselves, the sets of interactions and feedback loops that allow &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_34"&gt;independent&lt;/span&gt; agents to interact and self organize into larger processes.  &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_35"&gt;Elohayim&lt;/span&gt; is the set of principles that allow the multitude of discrete agents in '&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_36"&gt;olam&lt;/span&gt; (the world) to organize into patterns.&lt;br /&gt;&lt;br /&gt;Does that work for me personally?  For my community?  It is a reminder that my mind does not create this world around me, that i myself am a &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_37"&gt;dissipative&lt;/span&gt; process of molecules interacting, meaning that energy is flowing through me (not just into me) and this energy flow causes fluids and chemistry to form stable dynamic systems that can catch random fluctuations and create pattern). Can i rally around the patterns of physics and mathematics, do they give my life meaning?  Well, what else do i walk with and breath with  and how does this &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_38"&gt;elohayim&lt;/span&gt; serve as an organizing center for community?  why should a gathering of people show recognition of physics and mathematics and the principles of self organizing mathematics that energy flow through interacting particles creates stable &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_39"&gt;creative&lt;/span&gt; dynamical systems?&lt;br /&gt;&lt;br /&gt;well, for sure, every time a bunch of people want to get together and do something, they should realize how these principles work, that people self organize they are not &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_40"&gt;controlled&lt;/span&gt; by a politician, nor should they let themselves be. they should learn the ways of &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_41"&gt;dissipative&lt;/span&gt; and inculcate patterns of local interaction.&lt;br /&gt;&lt;br /&gt;and of course they should at these intense moments of prayer get out of their petty little mind-worlds, human society world, and realize that there is a larger earth around them a larger set of patterns that gives them the very gravity they move in, the very electromagnetic force that makes atoms, molecules, biology cohere.  thankful that the universe is an INTERESTING place, &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_42"&gt;otherwise&lt;/span&gt; we wouldn't be.&lt;br /&gt;&lt;br /&gt;And why does &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_43"&gt;yhvh&lt;/span&gt; and &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_44"&gt;elohayim&lt;/span&gt; have to be one and the same?  This is one of the cornerstones of the &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_45"&gt;Jewish&lt;/span&gt; tradition.  One God.  This doesn't work for me, I do not see evidence for it.  I do not require a neat simple system that collapses all primal organizing principles in my life into one being.  so i have to say:  &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_46"&gt;baruch&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_47"&gt;ata&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_48"&gt;yhvh&lt;/span&gt; who sparks into being, &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_49"&gt;toda&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_50"&gt;l'elohayim&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_51"&gt;melekh&lt;/span&gt; who is expansion and organization of the sparks into an '&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_52"&gt;olam&lt;/span&gt;.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-2583286201042708286?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/2583286201042708286/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=2583286201042708286' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2583286201042708286'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2583286201042708286'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/04/on-hebrew-prayer-organizing-principles.html' title='On Hebrew Prayer: Organizing Principles and Surprise'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-4710364202886206389</id><published>2011-04-08T12:41:00.001-05:00</published><updated>2011-04-08T12:43:22.087-05:00</updated><title type='text'>On Eating Animals</title><content type='html'>Life eats life to live.  Creatures all the time are domesticating each other, it is the process of symbiosis, parasitism, that's one of life's defining features. mothers give birth to varied children in overabundance as experiments in this grand evolutionary game.  delicately crafted &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_0"&gt;creatures&lt;/span&gt; that we in no way are capable of crafting ourselves are just food in the scheme of things.  our intensely strong consciousness of our very being, personality, individuality , our attachment to this strong sense of self, to the personality of others, these are also part of our mortal animal nature.&lt;br /&gt;&lt;br /&gt;this is all very hard for us very conscious clinging to ego beings to take.  it has always made it hard for us to take part in this cycling of life on earth.  can we choose to take ourselves out of this pattern and not eat animals?  i think for some that is a possible route if taking the life of animals causes them personal pain.&lt;br /&gt;&lt;br /&gt;however even if 6billion humans become vegetarian, this is not a life of do no harm.  we have to deny billions of other animals the right to their own vegetable food, room to live, not to mention the incredible burdens we put on ecosystems as a whole.&lt;br /&gt;&lt;br /&gt;one day we will have to come to terms with the fact that we are life, and this is the way life is, it is not a &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_1"&gt;mamby&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_2"&gt;pamby&lt;/span&gt; fairy existence.  life is gutsy and intricately intertwined with suffering and death.  the only way out of this reality is to take the poison &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_3"&gt;koolaid&lt;/span&gt; and believe your soul is going to live on some passing comet.  (in fact it is this &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_4"&gt;tendency&lt;/span&gt; to shy from the horrific reality of life and try to fly away to an idea of an eternal soul in heaven that i find one of the most dangerous aspects of many religions)&lt;br /&gt;&lt;br /&gt;The &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_5"&gt;bhagavad&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_6"&gt;Gita&lt;/span&gt; has an interesting view on this.  Arjuna is a warrior preparing to bring his army to battle.  he is standing on a mountain watching both armies prepare. the sight &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_7"&gt;overwhelms&lt;/span&gt; him, he begins to imagine all the death and suffering his soldiers will cause, and the families that will suffer when their soldier-fathers don't come back from battle, and... he freezes.&lt;br /&gt;&lt;br /&gt;So &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_8"&gt;Krishna&lt;/span&gt; comes and takes the whole rest of the book convincing him that there is no other way. if his army does not fight then the enemy army will also cause suffering to his people.  Krisha brings him to the very &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_9"&gt;pinnacle&lt;/span&gt; of experience of the horrific reality of life with its whirling giant maw of teeth and arms and eyes of creativity through destruction (for that is what the evolutionary process of life on this earth as been for the past 3.6billion years that has &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_10"&gt;produced&lt;/span&gt; the myriad crafted beings we are and share this life with) and then brings him back down to his reality, he is a warrior and his role is too fight.&lt;br /&gt;&lt;br /&gt;if i worried about every tiny ant i might step on, every animal who suffers in order for my crops to grow, if i worry about every person i may harm in my inept attempts at human interaction, if i worry about every chemical and machine and genetic defect out there that might cause me harm and shorter life, id never get out of the house and live. that is not the way.  i was created part of this vast living &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_11"&gt;couldron&lt;/span&gt;, and i choose to partake in it.&lt;br /&gt;&lt;br /&gt;that's what eating animals is about.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-4710364202886206389?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/4710364202886206389/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=4710364202886206389' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4710364202886206389'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4710364202886206389'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/04/on-eating-animals.html' title='On Eating Animals'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-5142758753513753989</id><published>2011-03-15T20:44:00.006-05:00</published><updated>2011-03-15T21:38:49.198-05:00</updated><title type='text'>I Have Seen The Future Of Art, and It Is The Jetsons</title><content type='html'>&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://4.bp.blogspot.com/-ckXLSQTtGI8/TYAWl7dC3QI/AAAAAAAAAPM/3ud2xgZDGGg/s1600/EMPAC.jpg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 400px; height: 229px;" src="http://4.bp.blogspot.com/-ckXLSQTtGI8/TYAWl7dC3QI/AAAAAAAAAPM/3ud2xgZDGGg/s400/EMPAC.jpg" alt="" id="BLOGGER_PHOTO_ID_5584488378809900290" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;I was walking  around at RPI today in Troy, NY, and came across  this EMPAC (Experimental Media and Arts Center) thing.&lt;br /&gt;&lt;br /&gt;So what is this all about, this high tech futuristic stuff?  It reminds me of that juvenile imagination of the glorious future we used to watch as kids on saturday mornings called the Jetsons.  and then i looked harder, and something actually looked familiar.  could it be?  I had to check:&lt;br /&gt;&lt;br /&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/-WheIdid9KjA/TYAX8BFycfI/AAAAAAAAAPc/i5uiSe9Nl1w/s1600/Jane_Jetson.jpg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 300px; height: 350px;" src="http://1.bp.blogspot.com/-WheIdid9KjA/TYAX8BFycfI/AAAAAAAAAPc/i5uiSe9Nl1w/s400/Jane_Jetson.jpg" alt="" id="BLOGGER_PHOTO_ID_5584489857791717874" border="0" /&gt;&lt;/a&gt;Yes, it's her!  Jane Jetson!  Million dollar serious performing arts center and it's modelled after a cartoon's hairdoo.  Hopefully I will write a more detailed deconstruction of this hideous piece of architecture shortly.&lt;br /&gt;&lt;br /&gt;Also, I'm taking up a collection to raise money to ship it off to the moon.&lt;br /&gt;&lt;br /&gt;Ok, i realize that's an artist's conception, so i found this photo (see below):&lt;br /&gt;&lt;br /&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/-D8yfEonUaaM/TYAhJBCze_I/AAAAAAAAAPk/y4Ceqtf44GA/s1600/www.timesunion.comEMPAC.jpeg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 400px; height: 296px;" src="http://2.bp.blogspot.com/-D8yfEonUaaM/TYAhJBCze_I/AAAAAAAAAPk/y4Ceqtf44GA/s400/www.timesunion.comEMPAC.jpeg" alt="" id="BLOGGER_PHOTO_ID_5584499976722152434" border="0" /&gt;&lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-5142758753513753989?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/5142758753513753989/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=5142758753513753989' title='5 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5142758753513753989'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5142758753513753989'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/03/i-have-seen-future-of-art-and-it-is.html' title='I Have Seen The Future Of Art, and It Is The Jetsons'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/-ckXLSQTtGI8/TYAWl7dC3QI/AAAAAAAAAPM/3ud2xgZDGGg/s72-c/EMPAC.jpg' height='72' width='72'/><thr:total>5</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-7214825646477699825</id><published>2011-03-11T02:10:00.003-05:00</published><updated>2011-03-12T20:35:56.637-05:00</updated><title type='text'>Swirls Of Sexvines In English and French!</title><content type='html'>&lt;span style="font-style:italic;"&gt;SWIRLS OF SEXVINES&lt;br /&gt;&lt;br /&gt;swirls of sexvines intoxicating,&lt;br /&gt;night perfumes of flowers&lt;br /&gt;calling moths, enticing them&lt;br /&gt;to mix pollen and imagine&lt;br /&gt;&lt;br /&gt;new beings, inviting danger,&lt;br /&gt;eruption of potent species&lt;br /&gt;into the forest.&lt;br /&gt;&lt;br /&gt;a memory of aroma of a night&lt;br /&gt;when i feared being only a moth&lt;br /&gt;but my death was death of the universe&lt;br /&gt;locked in my skull,&lt;br /&gt;&lt;br /&gt;infested with vines&lt;br /&gt;and sinews of thoughts and longings.&lt;br /&gt;&lt;br /&gt;bible verses came to attack&lt;br /&gt;but the jungle rotted them&lt;br /&gt;to ant food.&lt;br /&gt;&lt;br /&gt;longing for something to read,&lt;br /&gt;i picked up stars with my tongue&lt;br /&gt;but they stung ,&lt;br /&gt;so i burrowed under leaves&lt;br /&gt;and seeped into roots.&lt;br /&gt;&lt;br /&gt;the stars called me&lt;br /&gt;into veins in the night.&lt;br /&gt;&lt;br /&gt;i became many, and the rain&lt;br /&gt;washed me into puddles&lt;br /&gt;where i birthed a multitude&lt;br /&gt;of minute beings eating each other,&lt;br /&gt;living in each other's bellies,&lt;br /&gt;stitching the earth together in laughter,&lt;br /&gt;and it keeps growing...&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;TOURBILLION DE SEXVIGNES&lt;br /&gt;&lt;br /&gt;tourbillons de sexvignes&lt;br /&gt;parfum de nuit des fleurs enivrant&lt;br /&gt;appelant phalenes, les inciter a mélanger de pollen,&lt;br /&gt;imaginer des êtres nouveaux, inviter danger,&lt;br /&gt;eruption des espèces puissant dans la forêt,&lt;br /&gt;&lt;br /&gt;une mémoire de l'arôme d'une nuit&lt;br /&gt;où je craignais d'être seulement un papillon de nuit,&lt;br /&gt;mais ma mort était la mort de l'univers&lt;br /&gt;enfermé dans mon crâne infesté de vignes&lt;br /&gt;et les nerfs des pensées et des désirs.&lt;br /&gt;&lt;br /&gt;versets bibliques sont venus attaquer,&lt;br /&gt;mais la jungle les a pourri en ailments de fourmis.&lt;br /&gt;&lt;br /&gt;desirais ardemment pour quelque chose à lire&lt;br /&gt;je ramassé étoiles avec ma langue, mais ils piqué&lt;br /&gt;donc je s'enfouit sous les feuilles&lt;br /&gt;et je s'est infiltrées dans les racines,&lt;br /&gt;&lt;br /&gt;et les étoiles m'a appelé dans les veines dans la nuit&lt;br /&gt;et je suis devenu beaucoup&lt;br /&gt;&lt;br /&gt;et la pluie me rejetee dans les flaques ou je donné naissance&lt;br /&gt;à une multitude d'êtres vivants miniscules mangent&lt;br /&gt;les uns les autres, vivant dans les uns les autres ventres&lt;br /&gt;brodent la terre ensemble en rient et il ne cesse de croître...&lt;br /&gt;&lt;br /&gt;I'm sure i've hopelessly botched the verb tenses, and probably they are not consistant.  also i would have to read a bunch of french poetry (in storage) to find the right words with the right connotations.&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;&lt;/span&gt;&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-7214825646477699825?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/7214825646477699825/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=7214825646477699825' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7214825646477699825'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7214825646477699825'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/03/swirls-of-sexvines-in-english-and.html' title='Swirls Of Sexvines In English and French!'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-8931451388776323493</id><published>2011-01-07T14:11:00.009-05:00</published><updated>2011-01-07T15:38:45.344-05:00</updated><title type='text'>Elementary Algebra Final Exam I Gave Once (or use it as a review!)</title><content type='html'>&lt;pre&gt;&lt;span style="color: rgb(51, 0, 0);font-family:courier new;" &gt; &lt;br /&gt;BASIC MATH I    38103   FINAL EXAM                      12 NOV 1998&lt;br /&gt;                                   &lt;br /&gt;&lt;br /&gt;COPY DOWN EACH PROBLEM, AND THE PROBLEM NUMBER.  (YOU NEED NOT&lt;br /&gt;COPY THE LONG SENTENCES, ABBREVIATE!)  SHOW ALL WORK.  WRITE&lt;br /&gt;OUT ALL STEPS THAT YOU THINK OF. DON'T DO ANY IN YOUR HEAD.&lt;br /&gt;WORK SLOWLY BUT SURELY AND YOU WILL FINNISH IN TIME.  CIRCLE&lt;br /&gt;YOUR ANSWERS.  DON'T FORGET TO CHECK SOLUTIONS TO 'SOLVE FOR X'&lt;br /&gt;PROBLEMS.  LOOK AT THE ORIGINAL QUESTION WHEN YOU FINNISH A&lt;br /&gt;PROBLEM, TO MAKE SURE YOU'VE ANSWERED THE QUESTION.  QUESTIONS&lt;br /&gt;ARE WORTH 4 POINTS EACH (UNLESS MARKED LIKE []) TO MAKE A TOTAL&lt;br /&gt;OF 200 POINTS.  THERE ARE 4 PAGES, 57 PROBLEMS.&lt;br /&gt;&lt;br /&gt;PART I&lt;br /&gt;&lt;br /&gt;1) WHAT IS THE SLOPE OF THE LINE: Y= -3X+2 ?     [1]&lt;br /&gt;&lt;br /&gt;2) WHAT IS THE Y-INTERCEPT OF THE LINE Y=4X+3 ?  [1]&lt;br /&gt;&lt;br /&gt;3) DOES EVERY STRAIGHT LINE HAVE A Y-INTERCEPT?  [2]&lt;br /&gt;&lt;br /&gt;4) GRAPH THE LINE Y= -3&lt;br /&gt;.                          3&lt;br /&gt;5) GRAPH THE LINE    Y= - ---X + 6&lt;br /&gt;.                          2&lt;br /&gt;&lt;br /&gt;6) FIND THE VALUE OF THE SLOPE OF THE LINE BETWEEN THE POINTS:&lt;br /&gt;(6,3) AND (-2,3), OR TELL IF THE SLOPE IS UNDEFINED.&lt;br /&gt;&lt;br /&gt;7) WRITE THE EQUATION OF THE LINE WITH A SLOPE OF -3/2 THAT&lt;br /&gt;PASSES THROUGH THE POINT (-4,3)&lt;br /&gt;&lt;br /&gt;8) WRITE THE EQUATION OF THE LINE THAT PASSES THROUGH THE&lt;br /&gt;POINTS: (4,-5) AND (4,3)&lt;br /&gt;&lt;br /&gt;9) WRITE THE EQUATION OF THIS LINE:&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;PART II&lt;br /&gt;&lt;br /&gt;10) DOES EVERY SYSTEM OF EQUATIONS HAVE A SOLUTION?        [2]&lt;br /&gt;&lt;br /&gt;11) CAN A SYSTEM OF LINEAR EQUATIONS HAVE EXACTLY TWO DIFFERENT&lt;br /&gt;SOLUTIONS?                                                 [2]&lt;br /&gt;&lt;br /&gt;12) MATCH THE SYSTEM OF EQUATIONS WITH THE CORRECT CONCLUSION:&lt;br /&gt;                                                 [9]&lt;br /&gt;A) Y=2X+1        B) X+Y=1        C) X+Y=1&lt;br /&gt;.  Y=X+2            2X+2Y=2         2X+2Y=4&lt;br /&gt;&lt;br /&gt;1) NO SOLUTION      2) EXACTLY ONE     3) INFINITE NUMBER&lt;br /&gt;.                      SOLUTION           OF SOLUTIONS&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;.                                   2&lt;br /&gt;13) IS THE GRAPH OF THE EQUATION Y=X  A STRAIGHT LINE?  [bonus]&lt;br /&gt;&lt;br /&gt;SOLVE EACH SYSTEM OF LINEAR EQUATIONS. DON'T FORGET TO CHECK!&lt;br /&gt;&lt;br /&gt;14) BY SUBSTITUTION:     15) BY GRAPHING:       16) BY ADDITION:&lt;br /&gt;.   4X + Y = 14             Y = X - 1            X - Y = 4&lt;br /&gt;.   3X - 2Y = 5             2Y + X = 4           2X - 3Y = 9&lt;br /&gt;[6]                     [9]                 [6]&lt;br /&gt;&lt;br /&gt;PART III&lt;br /&gt;.                     -5       6&lt;br /&gt;17) WHICH IS BIGGER  4   OR   3  ?          [1]&lt;br /&gt;&lt;br /&gt;.                       2    2&lt;br /&gt;18) TRUE OR FALSE: (X+4)  = X + 16          [2]&lt;br /&gt;&lt;br /&gt;19) WHAT IS THE AREA OF THE FLOOR OF A ROOM 10 FT. WIDE, 8 FT.&lt;br /&gt;LONG AND 12 FT. HIGH?:&lt;br /&gt;A) 80 FT.  B) 960 SQUARE FT.  B) 960 CUBIC FT. C) 80 SQUARE FT.&lt;br /&gt;&lt;br /&gt;.        3  2  2    2                        0   0&lt;br /&gt;20) ( -3X  Y  ) *(4X Y) =              21)  4 * 3  =&lt;br /&gt;&lt;br /&gt;.           -2&lt;br /&gt;22) WRITE 10    AS A DECIMAL.&lt;br /&gt;&lt;br /&gt;SIMPLIFY, WRITING THE ANSWER WITHOUT NEGATIVE EXPONENTS.&lt;br /&gt;&lt;br /&gt;.      2  -2              0  2            7    -4&lt;br /&gt;23)  4X  Y       24)    4X  Y       25) (X )*(X  ) =&lt;br /&gt;.   --------          ----------&lt;br /&gt;.        2                -2  4&lt;br /&gt;.    (XY)              12Y   X&lt;br /&gt;&lt;br /&gt;.      3    2            2&lt;br /&gt;26) (8X - 3X - 4Y) - (-4X + 8X + 2Y) =&lt;br /&gt;&lt;br /&gt;.              2                               2&lt;br /&gt;27) (X-1) * ( X + X - 1) =           28) (4X-3)  =&lt;br /&gt;&lt;br /&gt;29) WRITE 0.00821 IN SCIENTIFIC NOTATION&lt;br /&gt;&lt;br /&gt;.                              -5              2&lt;br /&gt;30) WHICH IS GREATER?  8.98 X10    OR 1.001 X10     [2]&lt;br /&gt;&lt;br /&gt;.             2&lt;br /&gt;.           -X - X&lt;br /&gt;31) IF Y = --------   AND X= -2,   CALCULATE THE VALUE OF Y.&lt;br /&gt;.              3&lt;br /&gt;.             X&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;PART IV&lt;br /&gt;&lt;br /&gt;32)  HOW MANY DIFFERENT SOLUTIONS MIGHT A QUADRATIC EQUATION&lt;br /&gt;HAVE?                               [2]&lt;br /&gt;&lt;br /&gt;33) HOW MANY DIFFERENT SOLUTIONS MIGHT A 3RD DEGREE EQUATION&lt;br /&gt;HAVE?                               [bonus]&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;.          2&lt;br /&gt;34) SOLVE X = 4               35) FACTOR: 6X+9    [1]&lt;br /&gt;&lt;br /&gt;36) DO THE SOLUTIONS OF QUADRATIC EQUATIONS REFER TO THE POINTS&lt;br /&gt;OF INTERSECTIONS OF CURVED LINES OR STRAIGHT LINES?  [bonus]&lt;br /&gt;&lt;br /&gt;.             2                               3    2&lt;br /&gt;37) FACTOR: 2X - 5X - 3         38) FACTOR:  X - 6X  - 8X&lt;br /&gt;&lt;br /&gt;.                 2&lt;br /&gt;39) IS: 3X + 1 = 4   A QUADRATIC EQUATION?  SOLVE FOR X.&lt;br /&gt;&lt;br /&gt;.             2&lt;br /&gt;40) IS: 5X = X - 14   A QUADRATIC EQUATION?  SOLVE FOR X.&lt;br /&gt;&lt;br /&gt;SOLVE FOR X:&lt;br /&gt;&lt;br /&gt;.    2&lt;br /&gt;41) X +100 = 0&lt;br /&gt;&lt;br /&gt;.                                           3&lt;br /&gt;42) X(X+3) = 2X + 6                    43) X -9X = 0&lt;br /&gt;.                               2&lt;br /&gt;44) DIVIDE BY LONG DIVISION: (2X - 5X -3) - (X-3)&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;PART V&lt;br /&gt;&lt;br /&gt;45) ARRANGE THE FOLLOWING NUMBERS IN ORDER FROM THE SMALLEST TO&lt;br /&gt;LARGEST: 4     4     4     4     4     4     4&lt;br /&gt;.       ---,  ----, ---,  ---,  ---,  ---, -----&lt;br /&gt;.        2     1     8     1     4    -1     1&lt;br /&gt;.             ---                           ---&lt;br /&gt;.              2                            10&lt;br /&gt;.                              4&lt;br /&gt;46) WHERE WOULD THE FRACTION  ---, GO IF YOU IMAGINE IT HAS A&lt;br /&gt;VALUE?                         0                   [bonus]&lt;br /&gt;&lt;br /&gt;.                      2           2&lt;br /&gt;47) TRUE OR FALSE:    X + X       X&lt;br /&gt;[2]                ---------- =  ---&lt;br /&gt;.                     4 + X       4&lt;br /&gt;&lt;br /&gt;48) TRUE OR FALSE:       6X + 3      9&lt;br /&gt;.                       -------- = -----&lt;br /&gt;[2]                      X(X+1)     X+1&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;.                   2&lt;br /&gt;.                  X -3X - 28&lt;br /&gt;49) SIMPLIFY     --------------&lt;br /&gt;.                    2&lt;br /&gt;.                   X  - 49&lt;br /&gt;&lt;br /&gt;.               2              2&lt;br /&gt;.              X - 64         X -8X&lt;br /&gt;50) SIMPLIFY  ---------   -   -------&lt;br /&gt;.                                 2&lt;br /&gt;.              8X + 64          8X&lt;br /&gt;&lt;br /&gt;.             3       4&lt;br /&gt;51) ADD:     ---  + ----- =&lt;br /&gt;.             X      X+1&lt;br /&gt;&lt;br /&gt;.            X          2&lt;br /&gt;52) ADD   ------  -  ------- =&lt;br /&gt;.                      2&lt;br /&gt;.          2X+4       X +2X&lt;br /&gt;&lt;br /&gt;.                    3        4&lt;br /&gt;53) SOLVE FOR X:   -----  =  ---&lt;br /&gt;.                   X-2       X&lt;br /&gt;&lt;br /&gt;.                         6         3X&lt;br /&gt;54) SOLVE FOR X:   X +  -----  =  -----&lt;br /&gt;[6]                      X-2       X-2&lt;br /&gt;&lt;br /&gt;.                            1                1&lt;br /&gt;55) SIMPLIFY:           X - ---        56)  ------  =&lt;br /&gt;.                            X        [2]     1&lt;br /&gt;.                      ---------             ---&lt;br /&gt;.                        X + 1                2&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;PART VI&lt;br /&gt;&lt;br /&gt;CHOOSE ONE QUESTION AND WRITE ABOUT A HALF A PAGE ON IT.  USE&lt;br /&gt;EXAMPLES, EQUATIONS, CALCULATIONS, GRAPHS, ETC...  WRITE IN&lt;br /&gt;ENGLISH SENTENCES!                   [10]&lt;br /&gt;&lt;br /&gt;.          0&lt;br /&gt;A) WHY IS 4  =1?&lt;br /&gt;&lt;br /&gt;.                   2   3&lt;br /&gt;B) WHY CAN'T I ADD X + X = X  ?&lt;br /&gt;&lt;br /&gt;C) NOW LOOK OVER QUESTIONS #11, #13, #32 AND #36 AND DESCRIBE&lt;br /&gt;THE SITUATION IN DETAIL.&lt;br /&gt;&lt;br /&gt;.                4&lt;br /&gt;D) EXPLAIN WHY  ---  IS UNDEFINED.&lt;br /&gt;.                0&lt;br /&gt;&lt;br /&gt;Thank you.  I hope you learned more than just some algebra&lt;br /&gt;this semester.  I enjoyed your company.  Have a jolly winter!&lt;br /&gt;&lt;/pre&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-8931451388776323493?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/8931451388776323493/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=8931451388776323493' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8931451388776323493'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8931451388776323493'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/01/basic-math-i-38103-final-exam-12-nov.html' title='Elementary Algebra Final Exam I Gave Once (or use it as a review!)'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-5173982257758055310</id><published>2011-01-06T13:03:00.003-05:00</published><updated>2011-01-06T15:07:07.394-05:00</updated><title type='text'>How Should You Tilt a Bottle To Pour The Liquid Out Fastest?</title><content type='html'>Blackskimmmer:&lt;br /&gt;engineering question: tube closed at one open at the other. 1"wide, 6 feet long. filled to the brim with water.&lt;br /&gt;&lt;br /&gt;what angle below the hoizontal drains it the fastest?&lt;br /&gt;&lt;br /&gt;http://sfbay.craigslist.org/forums/?ID=67718622&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;1)&lt;br /&gt;90 degrees -- upside down would be fastest&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;are you sure? the bubbles get in the way.&lt;br /&gt;&lt;br /&gt;Zillionaire:&lt;br /&gt;nope.  Depends on how stable the tube. The "stickiness" of the water and geometry of the tube determines the angle... I think.&lt;br /&gt;&lt;br /&gt;Gotta find the optimum glug, glug frequecy, bubble size and fall rate...&lt;br /&gt;&lt;br /&gt;Um... 45 degrees?&lt;br /&gt;&lt;br /&gt;&lt;div id="titleLine"&gt;&lt;br /&gt;Zillionaire:&lt;br /&gt;Start at zero&lt;span class="fbod quote"&gt; go to 90&lt;/span&gt;     &lt;br /&gt;&lt;/div&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;describe the function of angle versus time&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Zillionaire:&lt;br /&gt;well...  If you did it really fast at the right focal point, you could generate significant cetripetal acceleration. How about infitity degrees per second?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;that's cheating, don't make things complicated yet.&lt;br /&gt;&lt;br /&gt;&lt;div id="titleLine"&gt;    Zillionaire:&lt;br /&gt;It is complicated,&lt;span class="fbod quote"&gt; I would need to know the properties of water  and air.&lt;/span&gt;     &lt;br /&gt;&lt;/div&gt;&lt;br /&gt;Cyclopia:&lt;br /&gt;Water weighs 1 gram/cc&lt;br /&gt;&lt;br /&gt;and is very wet.&lt;br /&gt;&lt;br /&gt;It's a good solvent, too.&lt;br /&gt;&lt;br /&gt;My favorite beers are about 94% water.&lt;br /&gt;&lt;br /&gt;And I am composed mostly of water.&lt;br /&gt;&lt;br /&gt;It's good stuff.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;1.6)&lt;br /&gt;Blackskimmmer:&lt;br /&gt;second guess the instabilities?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;tminus7:&lt;br /&gt;Rayleigh-Taylor instabilities.&lt;br /&gt;&lt;br /&gt;http://en.wikipedia.org/wiki/Rayleigh-Taylor_instability&lt;br /&gt;&lt;br /&gt;The real reason the water falls out of the tube.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;that article hardly made a lick'o' sense, but  i like the idea that crab nebula is RT fingers. my 2nd favorite place in the universe.&lt;br /&gt;&lt;br /&gt;well as i aint got no answers to my problem, i'll have to go out and get a tube and experiment myself.&lt;br /&gt;&lt;br /&gt;i'll report on it.&lt;br /&gt;&lt;br /&gt;why do you say these instablilties is why the water flows out of the tube? in the turbulent regime? or is it just what gets it initiating the flow?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;tminus7:&lt;br /&gt;It is what intiates the flow.&lt;br /&gt;&lt;br /&gt;Remember the only reason we are talking about this problem at all is that the outside air pressure is pushing the water back into the closed pipe with more force than the water weight pusing out. This is the condition Of RT instability. A low density fluid, air, pushing on a high density fluid, water. The simulation picture in the wiki article, if you turn it upside down is, is exactly the OP's problem. This is for the pipe straight vertical.&lt;br /&gt;&lt;br /&gt;One simple proof is the old playing card/ glass of water trick. Place a card over the open end of a glass of water. Hold it and invert the glass. Let go of the card and, magically, the water does not fall out! The card is a stiff solid and changes the conditions away from the RT condition. The card is not free to flow. But it shows the outside air pressure is great enough to hold the water (and card) in the glass. So gravity is insufficient to pull the water out of an inverted glass. You need RT to make it fall!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;aha! you are assuming that the if the water  leaves the tube at first without any air flowing all the way to the end first, that the water will have to leave a vacuum at the opposite end, and thus... i'm not sure i understand... ok i understand merely a bubble flowing up through the tube of water but it's flowing up because the water over it is flowing down it, bouyancy and all... i still don't understand how to make a free body diagram with the volume elements to show why things move...&lt;br /&gt;&lt;br /&gt;argh.... physics is hard!&lt;br /&gt;&lt;br /&gt;ok, at least with the card trick i see that if the water tries to bulge out the upsidown glass with the card, it's gotta leave a vacuum at the top.. so air pressure keeps the card horizontal..&lt;br /&gt;&lt;br /&gt;if i replace the card with the surface of the water... (surface tension effects? argghhh).. same problem, so .. you got to get some instability hapening... wow what would a movie be of the shape of the surface of that water the first millisecond that you remove the card (without causing any eddies where it touches... yikes, how to do it clean?)&lt;br /&gt;&lt;br /&gt;surface tension IS important. if you do the trick with a hollow glass stirir, the water doesnt come out at all! hmm... what's the cuttof diameter per given hight of column...&lt;br /&gt;&lt;br /&gt;yikes! fluids!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;2)&lt;br /&gt;Zillionaire:&lt;br /&gt;answer is: 0&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Zillionaire:&lt;br /&gt;i mean negative tan(dia/lenth)&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;curious suggestion. that's the angle of the triangle from the lip of the tube to the opposite edge.&lt;br /&gt;&lt;br /&gt;hmmm... gonna have to try this.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;InOldenDays:&lt;br /&gt;Yeah, nice idea, Z.&lt;br /&gt;&lt;br /&gt;Angular measure, though: "arctan" instead of "tan".&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;3)&lt;br /&gt;TheRealTryanJ:&lt;br /&gt;1 degree below hoizontal so it doesnt bulid vacum to prevent water from flowing.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;that's the idea! but how do you know 3degrees  isn't faster? tricky problem.&lt;br /&gt;&lt;br /&gt;i'm gonna have to go try it later.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;4)&lt;br /&gt;Geoloseth:&lt;br /&gt;the angle will have to change in relation to the amount of water left in the tube. In essence you tip it over and once it starts to drain you keep tipping it to the maximum angle before air gets trapped in the tube.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;that's a second version of the question.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;5)&lt;br /&gt;Toober:&lt;br /&gt;I'll guess.  The glu-glug frequency is a function of viscosity. I'm also not convinced that the recoil due to glugging would be enough to overcome a velocity of the maximum downward angle.&lt;br /&gt;&lt;br /&gt;BUT, assuming you want to minimize glugging. That means getting a complete layer of incoming air to the very back of the tube.&lt;br /&gt;&lt;br /&gt;So, place the tube at zero degrees horizontal, and draw a line from the lower open lip back to the upper closed lip. (you can figure it out from the dimensions you gave).I'm guessing that that is the minimum tipping angle for non-glugging.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;6)&lt;br /&gt;Blackskimmmer:&lt;br /&gt;Ok, here is the report on my preliminary experiments:&lt;br /&gt;&lt;br /&gt;well, i didn't get a tube yet, so i used two bottles:&lt;br /&gt;&lt;br /&gt;I) louza bottle 1.5" wide mouth, 12" high, 3"wide bottom walls fairly streight&lt;br /&gt;&lt;br /&gt;horizontal: 9sec&lt;br /&gt;10sec&lt;br /&gt;&lt;br /&gt;it starts off fast and then the last bits dribble out&lt;br /&gt;&lt;br /&gt;30deg? about 2 sec, some glugging&lt;br /&gt;&lt;br /&gt;45deg: 2sec? some glugging&lt;br /&gt;2.5sec&lt;br /&gt;&lt;br /&gt;vertical: 1.5sec&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;II)beer bottle: 3/4"opening, 4" of 1" neck, 10" tall, 2" at base&lt;br /&gt;&lt;br /&gt;horizontal: 20sec, glugging, doesn't empty all the way slows to a dribble etc..&lt;br /&gt;&lt;br /&gt;20deg? close to making the line from upper lip to rear bottom end horizontal: 11sec&lt;br /&gt;11sec&lt;br /&gt;&lt;br /&gt;45deg: 10sec fairly periodic glugging&lt;br /&gt;9 sec&lt;br /&gt;&lt;br /&gt;vertical: 8.5sec nonperiodic glugging? the glugging caused my hand to shake&lt;br /&gt;8.5sec&lt;br /&gt;7.5 sec&lt;br /&gt;8.5sec&lt;br /&gt;&lt;br /&gt;dynamic: 10sec&lt;br /&gt;10sec&lt;br /&gt;8 sec starting vertical and going more horizontal at end&lt;br /&gt;10sec&lt;br /&gt;9sec&lt;br /&gt;&lt;br /&gt;dynamic maintaining NO glugging: 16sec&lt;br /&gt;18sec&lt;br /&gt;&lt;br /&gt;dynamic vertical then horiz then final vertical spill: 9sec&lt;br /&gt;9sec&lt;br /&gt;&lt;br /&gt;none of the measurements are precise. to the nearest second because how well could i time when i released the water with my palm? i used my computers clock with seconds. windows XP and IBM thinkpad.&lt;br /&gt;&lt;br /&gt;http://sfbay.craigslist.org/forums/?ID=67868883&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;wow, i haven't done a physics exp in a while&lt;br /&gt;&lt;br /&gt;alot of work!&lt;br /&gt;&lt;br /&gt;analysis: while the glugging close to vertical is pretty bad, the speed of emptying between glugs and the speed of emptying at the end (less glugs) seems to more than make up for it.&lt;br /&gt;&lt;br /&gt;would be interesting to time precisely the vertical emptying times maybe 100 times and see what kind of distribution i get.&lt;br /&gt;&lt;br /&gt;would be interesting to analyse the periodicity of the gluging at various angles.&lt;br /&gt;&lt;br /&gt;curious that dynamically changing the angle i couldn't get much better timing!&lt;br /&gt;&lt;br /&gt;this is fun. it would be interesting to get a good long cylinder and a stand with a clamp and measure the angle (arcsin(height of rear end/len) more accurately. the longer the tube, the less imprecise my timings will be due to my impreciese "shutter" opening!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Toober:&lt;br /&gt;To standardize:&lt;br /&gt;&lt;br /&gt;When I had done similar experiments with students, we used PVC pipe closed-off with a PVC valve that you can cheaply purchase (&gt;$8?) at Home Depot. The experiments we had done were pressure vs. height vs. velocity experiments, but only at 90-degrees vertical.&lt;br /&gt;&lt;br /&gt;please consider this response: http://forums.newyork.craigslist.org/?act=Q&amp;amp;ID=67751574&lt;br /&gt;&lt;br /&gt;Someday, I'd like to get back to Newtonian experiments.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;yes, i hope to get around to finding some tubing, should be fun.&lt;br /&gt;&lt;br /&gt;i suppose if i had glass tubing i could do things like time how long a bubble takes to rise to the top. i recall an exhibit on davinci and one of the things he messed with was the chaotic motion of bubbles...&lt;br /&gt;&lt;br /&gt;Toober:&lt;br /&gt;He described bubbles,&lt;span&gt;&lt;/span&gt;&lt;span&gt;&lt;/span&gt;&lt;span&gt;&lt;/span&gt;&lt;span class="fbod quote"&gt; but only as a part of turbulence (as I recall from my readings). &lt;/span&gt;&lt;br /&gt;  &lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;this stuff, from:&lt;br /&gt;http://www.esam.northwestern.edu/~miksis/&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Computation of Moving Boundary Problems in Fluid Dynamics&lt;br /&gt;&lt;br /&gt;Rising gas bubbles play an important role in many physical and biological processes, such as the dynamics of multiphase flows, cavitation processes, and the flow of bubbles in the bloodstream. The rise of gas bubbles and the observation of a path instability has been documented since the time of Leonardo Da Vinci, but questions related to the origin of this instability still exist. CatherineNorman thesis topic was concerned with the development of a level-set numerical method to study the dynamics of rising bubbles. She considered both bubbles rising under an inclined plane and bubble free rising. She considered both cases were there was a film of liquid between the bubble and the plane and classes where there was a three-phase contact line. Hecode allowed for adaptive meshing and she developed a full second-order method.&lt;br /&gt;&lt;br /&gt;On the right is a numerical calculation using the level-set code of C. Normann. Here we see a three-dimensional gasbubble rising from rest. The bubble initially rising along the center-line and flattens in the direction it is moving. With increasing distance, a spiraling path instability occurs. Because the bubble is rising inside of a finite channel, the spiraling instability eventually becomes a zig-zag instability where the bubble move back and forth in a center-plane normal to two of the faces.&lt;br /&gt;References&lt;br /&gt;&lt;br /&gt;* C.Norman and M.J. Miksis, "Dynamics of a Gas Bubble in an Inclined Channel at Finite Reynolds Number", Phys. Fluids, 17(2), 022102, 2005.&lt;br /&gt;* C.Norman and M.J. Miksis, "Gas Bubble with a Moving Contact Line Rising in an Inclined Channel at Finite Reynolds Number", Physica D, 209, 191-204, 2005.&lt;br /&gt;* C.E. Norman, "A level-set numerical method to determine the dynamics of gas bubbles in inclined channels", Ph.D. Thesis, Northwestern University, June 2005.&lt;br /&gt;&lt;br /&gt;another description with davinci quote:&lt;br /&gt;&lt;br /&gt;http://ct-cr4.chem.uva.nl/single_bubble/nature.pdf&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-5173982257758055310?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/5173982257758055310/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=5173982257758055310' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5173982257758055310'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5173982257758055310'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/01/how-should-you-tilt-bottle-to-pour.html' title='How Should You Tilt a Bottle To Pour The Liquid Out Fastest?'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-1540371167876734465</id><published>2011-01-06T12:54:00.003-05:00</published><updated>2011-01-06T13:01:14.853-05:00</updated><title type='text'>When You Drip Milk In Coffee, Which One Splashes Up?</title><content type='html'>Preliminary discussion and experiments:&lt;br /&gt;&lt;br /&gt;Question:&lt;br /&gt;dripping drops into a pool of liquid.   when you drip liquid A into a pool of liquid B, one drop at a time, you get a tiny splash upon impact.&lt;br /&gt;&lt;br /&gt;Is the splash that you see a small amount of liquid B being flung into the air, or is it liquid A bouncing off of the surface of liquid B?&lt;br /&gt;&lt;br /&gt;http://sfbay.craigslist.org/forums/?ID=91386638&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;lets look:&lt;br /&gt;&lt;br /&gt;maybe the website describes the experimental setup and we could use two immiscible fluids of different colors to find out?&lt;br /&gt;&lt;br /&gt;cool pics of splashes:&lt;br /&gt;&lt;br /&gt;http://courses.ncssm.edu/hsi/class2000/splashes/pictures2.htm&lt;br /&gt;&lt;br /&gt;find the equations for this!&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;more pics and an article about bubbles in champagne:&lt;br /&gt;&lt;br /&gt;http://courses.ncssm.edu/hsi/class2005/splashes/a/Balloon_Index.htm&lt;br /&gt;&lt;br /&gt;http://courses.ncssm.edu/hsi/class2005/splashes/a/water_index.htm&lt;br /&gt;&lt;br /&gt;http://www.europhysicsnews.com/full/13/article3/article3.html&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Toober:&lt;br /&gt;Perhaps a moving frame of reference&lt;br /&gt;&lt;br /&gt;When I learned Navier Stokes as a chemical engineer, we always resorted to solvable boundary conditions within a static frame of reference (like a pipe wall, or sphere boundary, or rectangular channel). But I don't think that stasis is required. Or, another way to solve it is to treat the drop as a Newtonian sphere yet allow for "differentiable" elastic liquid smearing at the surface of impact. That's the ticket.&lt;br /&gt;&lt;br /&gt;2)&lt;br /&gt;well, my personal observation of dripping  half-n-half into a cup of black coffee, is that the splash is white.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;3)&lt;br /&gt;iamlucky13:&lt;br /&gt;Here's an example&lt;br /&gt;&lt;br /&gt;First of all, yes these are real. It's from a photo contest site I sometimes browse. The photographer spent hours setting them up.&lt;br /&gt;&lt;br /&gt;The ones to check out are the milk drops into coffee. You can see some mixing in the center column, but the outer edges appear to be mostly milk, suggesting that the milk drop rebounds against the coffee.&lt;br /&gt;&lt;br /&gt;http://www.dpchallenge.com/portfolio.php?USER_ID=52549&amp;amp;collection_id=20111&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;iamlucky13:&lt;br /&gt;Oops...correction&lt;br /&gt;&lt;br /&gt;Reading her comments in a the "Octopus" photo, it sounds like the white milk umbrella forms when a second drop impacts the rising coffee column from a previous drop.&lt;br /&gt;&lt;br /&gt;So the splash appears to be mixed coffee and milk.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;4)&lt;br /&gt;Blackskimmmer:&lt;br /&gt;my results: mixing&lt;br /&gt;&lt;br /&gt;water into soy milk from 6" to a foot, white spikes a cm or so&lt;br /&gt;soy milk into water from ditto white spikes a cm or so&lt;br /&gt;soy milk into olive oil from a foot, really viscous white blobs (the olive oil was in a 2cm deep bottle cap&lt;br /&gt;olive oil into soy milk 6" to a foot, white spikes a cm or so&lt;br /&gt;&lt;br /&gt;well, use imagination and interpret results. some mixing or at least the matrix fluid is clinging to the surface of the dropped fluid as it bounces back out.&lt;br /&gt;&lt;br /&gt;this is fun, i'll try more variations when i get some time&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-1540371167876734465?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/1540371167876734465/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=1540371167876734465' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1540371167876734465'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1540371167876734465'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/01/when-you-drip-milk-in-coffee-which-one.html' title='When You Drip Milk In Coffee, Which One Splashes Up?'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-8638944283557252684</id><published>2011-01-06T11:37:00.006-05:00</published><updated>2011-01-06T13:24:01.861-05:00</updated><title type='text'>Why Does Water Stay In The Straw With Your Thumb Over It?</title><content type='html'>Preliminary discussion and experiments:&lt;br /&gt;&lt;br /&gt;Hydrogyrophage:&lt;br /&gt;Question (possibly leading)&lt;br /&gt;&lt;br /&gt;You know that straw trick where you stick a straw in your drink, put your finger over the top of it, and pull the straw out of the drink so your straw is now full of water? And then you remove your finger, and all the liquid falls out.&lt;br /&gt;&lt;br /&gt;As I understand it, the liquid doesn't fall out while your finger is there because to do so, it would pull a vacuum in the space between your finger and the liquid.&lt;br /&gt;&lt;br /&gt;But if you tried this in a vacuum, doesn't that change it? If you're already in a vacuum, then you can't create more vacuum, so there should be nothing stopping the straw from allowing the vacuum to form between finger and liquid.&lt;br /&gt;[...]&lt;br /&gt;&lt;br /&gt;http://sfbay.craigslist.org/forums/?ID=158772545&lt;br /&gt;&lt;br /&gt;1)&lt;br /&gt;Blackskimmmer:&lt;br /&gt;i thought it was surface tension at the bottom  that holds the water in  place.&lt;br /&gt;&lt;br /&gt;do some simple experiments, try it with longer and wider  straws.&lt;br /&gt;&lt;br /&gt;after a certain width the lower surface breaks and the  water spills out, no?&lt;br /&gt;&lt;br /&gt;ditto with a longer straw? the weight of  the water above the lower surface will break it?&lt;br /&gt;&lt;br /&gt;now do i have  any tubing to try this with? now i'm not so sure about a longer straw...&lt;br /&gt;&lt;br /&gt;maybe  there is also the interface between the water and the straw that is  holding the water in there.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Kenguy119:&lt;br /&gt;You're a genius&lt;br /&gt;&lt;br /&gt;I was thinking about this after my initial reactive  post. And was thinking the real culprit is surface tension. What I was  thinking was what if the straw was 3 ft in diameter. No way it would  hold. Since a park is being built near by there was some waste PVC. I  tried my experiments and I couldn't get water to stay in anything with a  diameter of larger than .5 in.&lt;br /&gt;&lt;br /&gt;I liked your strait forward  logical approach.&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;wait, simpler experiment, try it with  soap in the water. or  another fluid with less surface tension.&lt;br /&gt;&lt;br /&gt;now where is that  staw...&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;HA experiment rules! just tried it, made a staw&lt;br /&gt;&lt;br /&gt;out of a pen, got the water  in it.&lt;br /&gt;&lt;br /&gt;touched the bottom with my finger, nothing&lt;br /&gt;&lt;br /&gt;touched  it with water, nothing.&lt;br /&gt;&lt;br /&gt;touched it with dish soap, boom! half of  it poured out till it reached half way up the straw, where there was no  longer soap and a miniscus formed again&lt;br /&gt;&lt;br /&gt;Hydrogyrophage:&lt;br /&gt;I know that surface  tension plays a part, but  not the whole part. Otherwise, removing your finger at the top wouldn't  cause the water to fall. Also, bulb pipettes would never work.&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;ok,  did you see my post above? the next peice of teh puzzle is when you  said the water doesn't  fall cause you can't make a vacuum between the water and your thumb. but  if the collumn of water is more than about 30 feet (at which the weight  of the water is = to the weight of the atmosphere of similar cross  section) the water DOES fall, and DOES leve a vacuum&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;ok, so  further experimentation with my straw (4" long by 1/4" inside diameter)  shows that when i lift  my finger, surface tension WILL keep the water in the straw if the  collumn is about 2 or 3mm high. that's the extent to the force due to  surface tension.&lt;br /&gt;&lt;br /&gt;it's confusing. with the finger, atmospheric  pressure holds the water up, but only if the surface tension is there.  once i break it, the interactions at the lower surface become complex  and...&lt;br /&gt;&lt;br /&gt;[...]&lt;br /&gt;&lt;br /&gt;Hydrogyrophage:&lt;br /&gt;Now this is EXACTLY what I was getting at!&lt;br /&gt;&lt;br /&gt;Atmospheric pressure HAS to play a role in siphons.&lt;br /&gt;&lt;br /&gt;Surface tension definitely works to counteract gravity to some extent  (see capillary action), but it also plays a role in preventing air from  moving through the liquid to the top.&lt;br /&gt;&lt;br /&gt;I wonder if the water in your experiments isn't forming bubbles when you  add the soap, which move to the top and allow the water to fall without  pulling a vacuum.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;thinking about the geometry and the forces at the surface of the water  with or without soap gave me a headache. maybe i'll think about it some  more.&lt;br /&gt;&lt;br /&gt;the surface tension allows the atmospheric pressure to act  on the entire surface as a whole, i.e. the lower surface essentially  becomes a rigid membrane. and thus the atmospheric pressure can exert  its force on the entire column.&lt;br /&gt;&lt;br /&gt;when i shake the tube when the  surface is convex out, a drop will pinch off, and the surface will  reform, flat or concave in.&lt;br /&gt;&lt;br /&gt;if i shake it some more a bubble will  form and will rise a certain distance, which i suppose means that the  collumn of water above it is sinking a distance of the thickness of the  bubble. it then usualy stops half way up the tube and gets stuck! maybe  at this point the collumn of water above it is not heavy enough to exert  enough force to move it and surface tension/adhesion holds it in place?&lt;br /&gt;&lt;br /&gt;another  puzzle. even with a column of air above a column of water, the water  does not spill out. it's got atm pressure below pushing up. but what's  the presure in the collumn of air above? i don't have the tools with  which to measure it.&lt;br /&gt;&lt;br /&gt;even if there is just a bubble, i don't know  if the volume of air forming the bubble gets expanded i the formation  of the bubble thus lowering the air pressure inside the bubble.&lt;br /&gt;&lt;br /&gt;it's  all very confusing.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;It's still confusing to me when you use  the phrase "pulling a vacuum"&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;2)&lt;br /&gt;Kenguy1192:&lt;br /&gt;For the Straw: A vacuum makes no difference. It isn't a pressure differential that is keeping the water "up" It is the seal (and therefore closed system) between the fluid, straw, and your finger, that prevent a bigger vacuum.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Hydrogyrophage:&lt;br /&gt;Now explain that one to me...&lt;br /&gt;&lt;br /&gt;What scientific principle keeps the liquid from falling?&lt;br /&gt;&lt;br /&gt;Can we draw a force diagram? What is acting on the liquid to counteract the force of gravity?&lt;br /&gt;&lt;br /&gt;FWIW (probably not much), Wikipedia claims that atmospheric pressure plays a part.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;force diagram... it's a fluid.. but, mg for the mass of liquid, down. air pressure times cross sectional area pushing up. now the complicated part: at the miniscus: it's i don't know what shape.. but it ISN'T horizontal! so that leads me to beleive that mg of the water is pushing down on it, and then there is the surface tension pulling with horizontal component towards the wall of the straw and vertical component up.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;better observation: for my 4" water column in  ~1/4 in. inner diameter plastic straw, i can make the bottom surface of the water convex, flat or concave.&lt;br /&gt;&lt;br /&gt;that's curious. wait, that's with air between the top of the water and my thumb...&lt;br /&gt;&lt;br /&gt;more experiments:&lt;br /&gt;&lt;br /&gt;so i immerse the straw and my thumb in teh glass of water: pull it out and no space between top of water and my thumb. the miniscus is convex, bowing downward.&lt;br /&gt;&lt;br /&gt;i shake it a little and a drop of water comes off, miniscus horizontal.&lt;br /&gt;&lt;br /&gt;shake it again, and teh miniscus goes concave into the straw.&lt;br /&gt;&lt;br /&gt;shake it again and another drop of water comes off and a BUBBLE sloooowly rises up the straw till it reaches finger, and now there's a region of AIR between the top of the water and my finger.&lt;br /&gt;&lt;br /&gt;but the water STILL doesn't pour out! hmm what's the miniscus at the top look like?&lt;br /&gt;&lt;br /&gt;lets see..&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;straw too cloudy at top to see, but here's something curious:&lt;br /&gt;&lt;br /&gt;holding column of water in with finger at top.&lt;br /&gt;&lt;br /&gt;shake it a little and drop of water comes out and bubble rises to the top of the collumn&lt;br /&gt;&lt;br /&gt;shake it again and another bubble rises half way and gets STUCK in the column of water, so there is from top to bottom:&lt;br /&gt;&lt;br /&gt;finger, thin layer of air, 2" column of water, 1/5" layer of air, 2" column of water!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Hydrogyrophage:&lt;br /&gt;You missed it.&lt;br /&gt;&lt;br /&gt;1) We can ignore the meniscus and surface tension forces. This is obviously not sufficient to keep the liquid suspended, as demonstrated when the finger at the top of the straw is removed.&lt;br /&gt;&lt;br /&gt;2) My question is regarding this situation in a vacuum, so air pressure is NOT what is pushing the water upward to counteract gravity.&lt;br /&gt;&lt;br /&gt;So what is?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;i know, my answer is only part of your  question... but wait, you at least read the results of my experiment? with the finger in place the water stays in the tube. when i destroy the surface tension with soap, the water pours out!&lt;br /&gt;&lt;br /&gt;onward:&lt;br /&gt;&lt;br /&gt;lets start here: if i raise the straw out of the water, mg in the column of the water is down. weight of atmosphere transmitted to the cross section of the straw at the surface pushes up.&lt;br /&gt;&lt;br /&gt;the water does not fall while the weight of the water is less than the weight of the atmosphere above that column.&lt;br /&gt;&lt;br /&gt;when you lift the straw up about 30 feet, finally the weight of the water IS greater and the higher you lift it, the water WILL fall, and WILL leave a vacuum below your finger.&lt;br /&gt;&lt;br /&gt;this is why we invented steam engines to work at the bottom of mines. pumps at the surface could not pull water up when it was below 30 feet!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;3) also, i failed to point out that probably with a THIN enough straw the water will probably stay in even with finger off.  but now maybe adhesive forces between water and the walls plays a part?  it's similar to my result of a 2-3mm tall column of water will stick in the tube with air above and below it and no finger holding top.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;4) We also had discussion of why siphoning water with a tube from one bucket to a lower bucket works. It's related but adds MORE complications.&lt;br /&gt;&lt;br /&gt;5) Important note from another discussion:&lt;br /&gt;&lt;br /&gt;tminus7:&lt;br /&gt;Rayleigh-Taylor instabilities. &lt;br /&gt;&lt;br /&gt;http://en.wikipedia.org/wiki/Rayleigh-Taylor_instability&lt;br /&gt;&lt;br /&gt;The real reason the water falls out of the tube.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Blackskimmmer:&lt;br /&gt;why do you say these instablilties is why the water flows out of the  tube? in the turbulent regime? or is it just what gets it initiating the  flow?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;tminus7:&lt;br /&gt; It is what intiates the flow. &lt;br /&gt;&lt;br /&gt;Remember the only reason we are talking about this problem at all is  that the outside air pressure is pushing the water back into the closed  pipe with more force than the water weight pusing out. This is the  condition Of RT instability. A low density fluid, air, pushing on a high  density fluid, water. The simulation picture in the wiki article, if  you turn it upside down is, is exactly the OP's problem. This is for the  pipe straight vertical.&lt;br /&gt;&lt;br /&gt;One simple proof is the old playing card/ glass of water trick. Place a  card over the open end of a glass of water. Hold it and invert the  glass. Let go of the card and, magically, the water does not fall out!  The card is a stiff solid and changes the conditions away from the RT  condition. The card is not free to flow. But it shows the outside air  pressure is great enough to hold the water (and card) in the glass. So  gravity is insufficient to pull the water out of an inverted glass. You  need RT to make it fall!&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-8638944283557252684?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/8638944283557252684/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=8638944283557252684' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8638944283557252684'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8638944283557252684'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2011/01/why-does-water-stay-in-straw-with-your.html' title='Why Does Water Stay In The Straw With Your Thumb Over It?'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-8946093042926890348</id><published>2010-12-31T11:08:00.002-05:00</published><updated>2010-12-31T11:29:58.381-05:00</updated><title type='text'>On R. Crumb's "The Book Of Genesis Illustrated"</title><content type='html'>http://www.amazon.com/Book-Genesis-Illustrated-R-Crumb/dp/0393061027&lt;br /&gt;&lt;br /&gt;very dissapointing.  He starts with an expansive epic text shimmering in mythic ambiguities, a text that counsels against pinning itself  in fixed images.  And then proceeds to pin it down with hundreds of tiny discrete literal images.&lt;br /&gt;&lt;br /&gt;very odd.  strange thing to see after so many years absorbed in the TEXT a text that says, no pictures!  so many years in playing with the wordplay, the resonance between words that weave the text together.  the poetry, the mythic qualities.  the epic qualities.&lt;br /&gt;&lt;br /&gt;on the illustrations: i was dissapointed with the pedestrian imagiinations with the text.  when i read torah, i perceive mythic stories with epic proportion. after all it starts with the creation of the then known universe and the interaction with the creator of that universe...&lt;br /&gt;&lt;br /&gt;when i read the text, which is extremely terse, which calls out for expansion, as indeed the rabbis through the ages expanded it in countless midrashes, reading between the lines, i too expand the stories.  so it is dissapointing to see no expansion here.  he illustrates exactly what is in the text, he does not extrapolate.  he does not draw out the connections between the stories (and indeed the connections carry out between stories throughout the whole old testament!).&lt;br /&gt;&lt;br /&gt;And of course the ultimate insult to the text, is a literal reading of it.  As it is written, the text is incomplete, full of ambiguities, mere suggestions in so many places.  and the purpose of the text, in the jewish tradition is that we are called to go with those hints, to create our own connections, extrapolations.  the text cries out for it, and the tradition is seeped in this activity.  It is holy.  But Crumb's illustrations rather than preserving these ambiguities, pins them down in fixed graphics.&lt;br /&gt;&lt;br /&gt;Language is a much more powerful medium for creating ambiguities, holding paradox, multiple viewpoints in the mind.  It takes extraordinary efforts i.e. M. C. Escher and Picasso (and these are rather trivial cases) to do this in graphics.&lt;br /&gt;&lt;br /&gt;one thing that really bothered me was that he wasted a LOT of panels just drawing faces showing various facial expressions in response to the text.  instead he could have drawn images of what the text suggests, he could have drawn out the messages behind the text, the connections with other parts of the story, played on the poetry of the text, more of the mythic elements.&lt;br /&gt;&lt;br /&gt;it's so focused on the individuals, petty human stories, but the individuals also clearly 'stand for' archetypes and peoples.  Israel is at the same time a person and the whole people israel themselves.  Adam is at the same time an individual (not much of one) and all humanity.  Moab son of Lot is at the same time the whole people, the Moabites whith much future roles to play in the story ahead...&lt;br /&gt;&lt;br /&gt;another point on the literalism of his illustrations: he draws god as a bearded old man.  Now as Elohim, say in the first creation story, Elohim is clearly a force of nature and not a personality for humans to respond to.  and even as yhvh, a much more personal presence that humans relate to... the point of tora is that yhvh is a voice, a calling, not an experience you can pin down in a picture.&lt;br /&gt;&lt;br /&gt;there are plenty of instances for Crumb to draw, where god comes down as a messanger, i.e. when he comes to Abraham to announce he will have a child, and then argue with him about destroying Sodom.&lt;br /&gt;&lt;br /&gt;I mean, you've got to build up to the point in Exodus where yhvh is clearly a monstrous volcanic force to be wrestled with, who does NOT even show his face, even to Moses.&lt;br /&gt;&lt;br /&gt;In all, the text has always struck me as WAY bigger than Crumb draws it.&lt;br /&gt;&lt;br /&gt;on the plus side, focusing as he does on the characters, i did come to some new excitiing realizations about what was going on with these characters.  they made many messes of their lives and their children's lives.  finally culminating in the reconciliation and forgiveness that joseph finally performs, closing the story.  an interesting message.  with larger closings as the old testament goes on, culminating in the reconcilation of Moab and Israel in the story of Ruth.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-8946093042926890348?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/8946093042926890348/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=8946093042926890348' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8946093042926890348'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8946093042926890348'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2010/12/on-r-crumbs-book-of-genesis-illustrated.html' title='On R. Crumb&apos;s &quot;The Book Of Genesis Illustrated&quot;'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-4721093136777119446</id><published>2010-12-09T10:17:00.001-05:00</published><updated>2010-12-09T10:19:38.894-05:00</updated><title type='text'>More on the collatz function, i'll post info later</title><content type='html'>&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/_uPFMFfHgGGg/TQDzWQoxGiI/AAAAAAAAAO8/pozN699TTRg/s1600/histogram%2B100%252C000%2Blogarithmic.gif"&gt;&lt;img style="cursor: pointer; width: 400px; height: 274px;" src="http://1.bp.blogspot.com/_uPFMFfHgGGg/TQDzWQoxGiI/AAAAAAAAAO8/pozN699TTRg/s400/histogram%2B100%252C000%2Blogarithmic.gif" alt="" id="BLOGGER_PHOTO_ID_5548702304669080098" border="0" /&gt;&lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-4721093136777119446?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/4721093136777119446/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=4721093136777119446' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4721093136777119446'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4721093136777119446'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2010/12/more-on-collatz-function-ill-post-info.html' title='More on the collatz function, i&apos;ll post info later'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://1.bp.blogspot.com/_uPFMFfHgGGg/TQDzWQoxGiI/AAAAAAAAAO8/pozN699TTRg/s72-c/histogram%2B100%252C000%2Blogarithmic.gif' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-8647179893681583042</id><published>2010-12-07T15:01:00.001-05:00</published><updated>2010-12-07T15:02:40.276-05:00</updated><title type='text'>WHAT MAKES THIS?</title><content type='html'>&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://4.bp.blogspot.com/_uPFMFfHgGGg/TP6S16y0wSI/AAAAAAAAAO0/x2LPUqvqGR0/s1600/what%2Bam%2Bi.gif"&gt;&lt;img style="cursor: pointer; width: 400px; height: 274px;" src="http://4.bp.blogspot.com/_uPFMFfHgGGg/TP6S16y0wSI/AAAAAAAAAO0/x2LPUqvqGR0/s400/what%2Bam%2Bi.gif" alt="" id="BLOGGER_PHOTO_ID_5548033245980180770" border="0" /&gt;&lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-8647179893681583042?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/8647179893681583042/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=8647179893681583042' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8647179893681583042'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8647179893681583042'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2010/12/what-makes-this.html' title='WHAT MAKES THIS?'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/_uPFMFfHgGGg/TP6S16y0wSI/AAAAAAAAAO0/x2LPUqvqGR0/s72-c/what%2Bam%2Bi.gif' height='72' width='72'/><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-6053882083958643062</id><published>2010-08-08T09:27:00.008-05:00</published><updated>2011-09-27T17:48:51.746-05:00</updated><title type='text'>Simple Chemistry Makes Mercury Blob Oscillate Into Different Shapes</title><content type='html'>As part of my ongoing exploration for my complexity lab manual, for examples of simple energy flow producing complex patterns, I've found this &lt;a href="http://jchemed.chem.wisc.edu/JCESoft/CCA/pirelli/pages/cca3heart.html"&gt;mercury blob oscillator&lt;/a&gt;. (The web page includes a video)&lt;br /&gt;&lt;br /&gt;What's happening here is basically that potassium dichromate is rusting the nail.  This is a spontaneous process in which energy is released, in fact it releases the energy we put into the iron nail when we refined it from its ore (another form of rust!).  That release of energy is what runs the whole fascinating process.&lt;br /&gt;&lt;br /&gt;The reaction takes place by putting a mercury blob in a dilute solution of sulfuric acid and placing an iron nail next to it.  Then i think in the video, the experimenter drops some potassium &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_1"&gt;dichromate&lt;/span&gt; into the solution to get it started.  This simple setup of water, mercury blob, nail, sulfuric acid and potassium dichromate is enough to produce complex motion.&lt;br /&gt;&lt;br /&gt;Basically the reaction is that the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_2"&gt;dichromate&lt;/span&gt; oxidizes the iron nail.  This is similar to the process of rusting, which happens spontaneously in our oxygen filled atmosphere.  However, this reaction happens slowly.  By placing a mercury blob close to the iron nail, the reaction is sped up, and fun things happen.  Mercury is a fluid with a high surface tension and this causes it to form round blobs, like water drops on a waxy surfaces (leaves, feathers..).&lt;br /&gt;&lt;br /&gt;First, the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_3"&gt;dichromate&lt;/span&gt; in the solution oxidizes the mercury, forming a layer of mercury sulfate (like a layer of rust on iron).  This layer of rust doesn't have as much surface tension as the pure mercury does, so the blob flattens out.  As with any oxidation reaction, while the mercury is oxidized, the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_4"&gt;dichromate&lt;/span&gt; Cr2O7(2-) is reduced to the chromium (III) ion.  Eventually the blob flattens out enough to touch the nail, now the mercury sulfate layer oxidizes the iron, and again, since  the iron is oxidized, the mercury sulfate becomes reduced back  to liquid mercury, the blob rounds up again, and the process repeats.&lt;br /&gt;&lt;br /&gt;You see in the video that once the experimenter has adjusted the position of the nail just right, the blob then begins to oscillate by itself.  It does so in very curious ways! Oscillating in a square shape and then it seems to switch to a triangular shape!  Part of this process is mediated by the fact that oxidation/reduction involves a transfer of electrons, and I suppose that the mercury blob will conduct the electrons away from the point of contact with the nail and spread them to the whole surface of rust to reduce it back to mercury.  Perhaps different patterns of oscillation would form if the nail were positioned above the center of the blob or even more than one nail were used.&lt;br /&gt;&lt;br /&gt;The interesting part of the process is that while the net result of the reaction is that all of the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_5"&gt;dichromate&lt;/span&gt; is eventually reduced to chromium ions and then the process comes to a halt, on the way, the intermediate stage of mercury oxidation and reduction can oscillate.&lt;br /&gt;&lt;br /&gt;(This is similar to how the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_6"&gt;BZ&lt;/span&gt; reaction works (another complexity lab) where the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_7"&gt;bromate&lt;/span&gt; oxidizes all the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_8"&gt;malate&lt;/span&gt; to carbon dioxide, but on the way, the intermediate reaction, oxidation/reduction of cerium or iron also oscillates and forms the colored patterns on the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_9"&gt;petri&lt;/span&gt; dish.)&lt;br /&gt;&lt;br /&gt;This oxidation and reduction of metals is basically how your battery runs your &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_10"&gt;ipod&lt;/span&gt; to make your &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_11"&gt;earbuds&lt;/span&gt; oscillate in interesting patterns called music!  One metal is oxidizing another metal inside the battery.  Eventually the battery runs down.  In essence this blob oscillator is the battery and motor combined!&lt;br /&gt;&lt;br /&gt;In fact almost everything interesting that happens on earth happens in this manner.  For instance we, and all living creatures, can move around and have oscillations (breathing, heart beating..) because these are intermediate reactions within the ultimate process of oxidizing food to carbon dioxide.  Even the patterns of weather across the planet is a process of oscillations and cycles that mediate the flow of heat from the sun to outer space as it passes though the earth's atmosphere.&lt;br /&gt;&lt;br /&gt;It is true that one day the sun will stop 'burning' and all energy flow will cease.  This is what the second law of thermodynamics is all about, that, by itself, the entire universe is running down to a state of high entropy (randomness).  The point of these labs, is to show that in the meanwhile, this process of running down drives the spontaneous formation of interesting stable patterns.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-6053882083958643062?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/6053882083958643062/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=6053882083958643062' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/6053882083958643062'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/6053882083958643062'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2010/08/simple-chemistry-makes-mercury-blob.html' title='Simple Chemistry Makes Mercury Blob Oscillate Into Different Shapes'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-5589178685898974956</id><published>2010-04-18T10:57:00.002-05:00</published><updated>2010-04-18T11:00:33.175-05:00</updated><title type='text'>Robin poetry</title><content type='html'>I want to know what the birds are saying!&lt;br /&gt;&lt;div id="description" class="module clearfix"&gt;&lt;div class="datawrap"&gt;&lt;br /&gt;Robins make up their songs in a series of verses.  most of  the time i hear them sing about 4 to 6 phrases or tweets per verse.    Robins usually know about a dozen or two different kinds of tweets.   Often at the end of each verse they will sing a very high pitched  'hissely'.  When analyzed with a computer, we find that robins sing  about 50 different kinds of hisselys.  Odd. I don't remember how they  learn their tweets, either from each other or they make them up as they  mature.  Either way, each robin knows a distinct set of tweets.&lt;br /&gt;&lt;br /&gt;What  are they saying?  How carefully are they composing? According to  studies reported by Donald Kroodsma, in his book "the singing life of  birds" many birds definitely are composing as they go.  Either learning  from each other, reacting to each other...  The brown thrasher has been  recorded to know about a 1000 different tweets, which it sings in very  quick succession, improvising many on the spot.  A Charlie Parker of  birds.&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.thesinginglifeofbirds.com/" target="_blank" rel="nofollow" onmousedown="'UntrustedLink.bootstrap($(this),"&gt;&lt;span&gt;http://www.thesinginglifeo&lt;/span&gt;&lt;wbr&gt;&lt;span class="word_break"&gt;&lt;/span&gt;fbirds.com/&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;here's a Robin reciting poetry at Riverside Park in NYC.&lt;br /&gt;&lt;br /&gt;&lt;object width="320" height="266" class="BLOG_video_class" id="BLOG_video-f61d9941adab6d5a" classid="clsid:D27CDB6E-AE6D-11cf-96B8-444553540000" codebase="http://download.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=6,0,40,0"&gt;&lt;param name="movie" value="http://www.youtube.com/get_player"&gt;&lt;param name="bgcolor" value="#FFFFFF"&gt;&lt;param name="allowfullscreen" value="true"&gt;&lt;param name="flashvars" value="flvurl=http://v4.nonxt4.googlevideo.com/videoplayback?id%3Df61d9941adab6d5a%26itag%3D5%26app%3Dblogger%26ip%3D0.0.0.0%26ipbits%3D0%26expire%3D1330375010%26sparams%3Did,itag,ip,ipbits,expire%26signature%3D5245C134ED63C409BCD1CCC8047AF5AC58F4C527.495ED960EC4BE2CB19F793B7D1AB9C86DD5A419E%26key%3Dck1&amp;amp;iurl=http://video.google.com/ThumbnailServer2?app%3Dblogger%26contentid%3Df61d9941adab6d5a%26offsetms%3D5000%26itag%3Dw160%26sigh%3DbVoCc9ByIlGH6Jh7IoeKbpyQRqI&amp;amp;autoplay=0&amp;amp;ps=blogger"&gt;&lt;embed src="http://www.youtube.com/get_player" type="application/x-shockwave-flash"width="320" height="266" bgcolor="#FFFFFF"flashvars="flvurl=http://v4.nonxt4.googlevideo.com/videoplayback?id%3Df61d9941adab6d5a%26itag%3D5%26app%3Dblogger%26ip%3D0.0.0.0%26ipbits%3D0%26expire%3D1330375010%26sparams%3Did,itag,ip,ipbits,expire%26signature%3D5245C134ED63C409BCD1CCC8047AF5AC58F4C527.495ED960EC4BE2CB19F793B7D1AB9C86DD5A419E%26key%3Dck1&amp;iurl=http://video.google.com/ThumbnailServer2?app%3Dblogger%26contentid%3Df61d9941adab6d5a%26offsetms%3D5000%26itag%3Dw160%26sigh%3DbVoCc9ByIlGH6Jh7IoeKbpyQRqI&amp;autoplay=0&amp;ps=blogger"allowFullScreen="true" /&gt;&lt;/object&gt;&lt;br /&gt;&lt;br /&gt;The first step in  decoding what this robin is saying is to count the number of tweets in  each verse:&lt;br /&gt;&lt;br /&gt;riverside robin sings&lt;br /&gt;5&lt;br /&gt;6&lt;br /&gt;7&lt;br /&gt;7&lt;br /&gt;6&lt;br /&gt;6&lt;br /&gt;6&lt;br /&gt;6&lt;br /&gt;6&lt;br /&gt;&lt;br /&gt;then  you chart out his song:&lt;br /&gt;&lt;br /&gt;5 _ _ _ _ _&lt;br /&gt;6 _ _ _ _ _ _&lt;br /&gt;7 _ _ _  _ _ _ _&lt;br /&gt;7 _ _ _ _ _ _ _&lt;br /&gt;6 _ _ _ _ _ _&lt;br /&gt;6 _ _ _ _ _ _&lt;br /&gt;6 _ _ _  _ _ _&lt;br /&gt;6 _ _ _ _ _ _&lt;br /&gt;6 _ _ _ _ _ _&lt;br /&gt;&lt;br /&gt;then you start listening  for tweets you recognize and fill them into the spaces.  eventually you  transcribe his song.  Here is my transcription:&lt;br /&gt;&lt;br /&gt;riverside robin:&lt;br /&gt;\  \ ~ ~ '&lt;br /&gt;\ \ ~ ~ w V (end of verse)&lt;br /&gt;&lt;br /&gt;\ \ ~ ~ ~ w&lt;br /&gt;\ ~ ~ ~ w V  (end of verse&lt;br /&gt;&lt;br /&gt;^ v ^ v _ .&lt;br /&gt;^ v ^ w ~ w&lt;br /&gt;&lt;br /&gt;^ v ^ v ^ v&lt;br /&gt;^  v ^ v ^ v&lt;br /&gt;^ v ^ v ^ .&lt;br /&gt;&lt;br /&gt;Now of course this is as a human hears  it.  I hear a set poem.  I don't know how robins hear it.  I would like  some day to record lots of robins and hear if they often make structures  like this.&lt;br /&gt;&lt;br /&gt;I suppose the test is to make up our own robin poems  and see how other robins respond to them.  Ongoing research!&lt;/div&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-5589178685898974956?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/5589178685898974956/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=5589178685898974956' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5589178685898974956'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5589178685898974956'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2010/04/robin-poetry.html' title='Robin poetry'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-1562002386557758976</id><published>2010-02-28T18:35:00.010-05:00</published><updated>2010-03-02T12:17:04.645-05:00</updated><title type='text'>Euplotidium's Spears</title><content type='html'>&lt;a style="color: rgb(0, 0, 0);" onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://4.bp.blogspot.com/_uPFMFfHgGGg/S4r-y8vobxI/AAAAAAAAAN0/PSMS2hqWfT4/s1600-h/euplotidium+1.jpg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 256px; height: 400px;" src="http://4.bp.blogspot.com/_uPFMFfHgGGg/S4r-y8vobxI/AAAAAAAAAN0/PSMS2hqWfT4/s400/euplotidium+1.jpg" alt="" id="BLOGGER_PHOTO_ID_5443443250883489554" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);font-size:130%;" &gt;&lt;span style="font-weight: bold;"&gt;Symbiotic bacteria found to defend its host with cell structures previously thought to be exclusive to more complex organisms&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;The ciliate Euplotidium has what appears to be symbiotic bacteria on its surface that defend it against predators with extrusive spears&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;These bacteria were found to contain structures that react to tests for eukaryotic microtubules.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;However, microtubules had never been found in bacteria before, and are in fact one of the defining features of the more complex kingdom of organisms called eukaryotes (animals, plants and protozoa), serving to organize their more complex cell structures and processes such as the dance of mitosis, another defining feature exclusive to eukaryotes.&lt;/span&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[6] [7] [8]&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;If these turn out to be microtuble containing bacteria, the discovery would be a major one for biology.  The Eukaryotes likely evolved from the bacteria and their relatives.  While we understand some of the steps, so far we have no clues as to the origins of the complex strtuctures and processes involving microtubules. [9] [10] [11] [12]&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;Euplotidium arenarium and E. itoi are marine hypotrich ciliates (eukaryote) found in tide pools along rocky shores.  The defensive bacteria, called epixenosomes, are arranged in a distinct band around the host cells.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;There are many cases of bacterial ectosymbionts on eukaryotes, and these at first seemed to be another case.&lt;/span&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[2] [13]&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;But probes designed to detect bacterial ribosomal RNA genes (rRNA) wouldn't bind these epixenosomes.  This, together with the fact that they  contained structures that reacted to tests for eukaryotic microtubules, led biologists to conclude that they were of eukaryotic origin and not bacteria.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;a style="color: rgb(0, 0, 0);" onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://4.bp.blogspot.com/_uPFMFfHgGGg/S4sAsezRw4I/AAAAAAAAAOE/pfaeAc1vjv4/s1600-h/euplotidium+pic+2.jpeg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 264px; height: 400px;" src="http://4.bp.blogspot.com/_uPFMFfHgGGg/S4sAsezRw4I/AAAAAAAAAOE/pfaeAc1vjv4/s400/euplotidium+pic+2.jpeg" alt="" id="BLOGGER_PHOTO_ID_5443445338789757826" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;The life cycle of these ectosymbiotic bacteria are keyed to the life cycle of the host ciliate.  They start off looking like typical small spherical bacteria, then they develop the complex coiled ribbon structures.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;When the predatory ciliate Litonotus attempts to capture and ingest Euplotidium cells, these coiled ribbons spring open to form filaments up to 8 times longer than the epixenosomes, repelling the predator.  When the epixenosomes are experimentally removed, Litonotus has no trouble ingesting Euplotidium.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;a style="color: rgb(0, 0, 0);" onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/_uPFMFfHgGGg/S4sH3E0_zeI/AAAAAAAAAOk/sZLTK8dPGdE/s1600-h/euplotidium+pic+3.jpeg"&gt;&lt;img style="cursor: pointer; width: 320px; height: 62px;" src="http://1.bp.blogspot.com/_uPFMFfHgGGg/S4sH3E0_zeI/AAAAAAAAAOk/sZLTK8dPGdE/s320/euplotidium+pic+3.jpeg" alt="" id="BLOGGER_PHOTO_ID_5443453217377603042" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;These defensive structures are different than the trichocysts typically found on ciliates.&lt;/span&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[3] [4] [5]&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;In a recent study Giovanna Rosati and coauthors make a strong case that these bodies are bacteria.  [1] She and her team used a novel technique to develop a new bacterial rRNA probe that bind to these bacteria.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;For comparison, DNA was extracted from cells of Euplotidium with and without their symbionts.  Then both DNA samples were tested for bacterial 16S rRNA genes.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;Just as previous attempts to detect these genes in the epixenosomes had failed, so did their initial trials using standard bacterial probes on both DNA samples.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;So they modified the standard probe to include gene sequences from the other prokaryotic kingdom called Archaea.  With these they obtained positive results from the samples with the symbionts, and not from those without.&lt;/span&gt;&lt;br /&gt;&lt;a style="color: rgb(0, 0, 0);" onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/S4sEjp9e-yI/AAAAAAAAAOU/OsaW8p18QFY/s1600-h/extruded+epixenosomes+marked+by+probe+for+bacterial+genes.jpg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 200px; height: 191px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/S4sEjp9e-yI/AAAAAAAAAOU/OsaW8p18QFY/s200/extruded+epixenosomes+marked+by+probe+for+bacterial+genes.jpg" alt="" id="BLOGGER_PHOTO_ID_5443449585213045538" border="0" /&gt;&lt;/a&gt;&lt;a style="color: rgb(0, 0, 0);" onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/S4sE3IN4_jI/AAAAAAAAAOc/tfUI1eYgS8g/s1600-h/cortical+band+of+epis+marked+by+probe.jpg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 200px; height: 188px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/S4sE3IN4_jI/AAAAAAAAAOc/tfUI1eYgS8g/s200/cortical+band+of+epis+marked+by+probe.jpg" alt="" id="BLOGGER_PHOTO_ID_5443449919752437298" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;They could then create probes attached to fluorescent green molecules to use on complete Euplotidium cells.  Their photomicrographs show the bacterial probes binding only to the cortical band of epixenosomes, and their extruded barbs.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;When they compared the genes extracted from the epixenosomes to other bacterial genes, they found the closest matches to be in the little known newly discovered bacterial division Verrumicrobia.  So far, only two species of bacteria have been identified in this group.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;They conclude that these epixenosomes are in fact bacteria.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;The relationship to the Verrucomicrobia is interesting because most other bacterial symbionts belong to the large well known division Proteobacteria.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;It was also found that these 16S rRNA genes have two mutations not found in the genes routinely used for bacterial probes, and is likely the cause of the previous failure of this probe to bind to these bacteria.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;This result points to the possibility that there are other undetected Verrucomicrobia bacteria out there awaiting discovery.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;So there is a mystery afoot!  One possiblity is that these are still eukaryotic organelles that for some reason contain bacterial rRNA genes.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;A more interesting possibility is that these bacteria at some point acquired genes for microtubules from a eukaryote, possibly their host.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;But the most exciting possibliity is that these bacteria are ancient relicts of a lineage of bacteria which had something to do with the evolutionary appearance of the eukaryotes, which is an event still shrouded in mystery.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;References:&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;Images by Giavanna Rosati from&lt;/span&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;http://schaechter.asmblog.org/schaechter/2007/01/ciliate_007.html&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;and&lt;/span&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;http://www.pnas.org/content/97/4/1813.full&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[1] Giulio Petroni, Stefan Spring, Karl-Heinz Schleifer, Franco Verni, and Giovanna Rosati (2000) "ectosymbionts of Euplotidium (Ciliophora) that contain microtubule-like structures are bacteria related to Verrucomicrobia", Proceedings of the National Academy of Sciences, 97 no. 4, 1813-1817&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;http://www.pnas.org/content/97/4/1813.full&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[2]  Ahmadjian, Vernon and Paracer, Surindar (1986) "Symbiosis an introduction to Biological Associations" pg 117&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[3] Harumoto, T. &amp;amp; Miyake, A. (1991) J. Exp. Zool. 260, 84-92[ISI].&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[4] Knoll, G., Haacke-Bell, B. &amp;amp; Plattner, H. (1991) Eur. J. Protistol. 27, 381-385[ISI].&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[5] Miyake, A. &amp;amp; Harumoto, T. (1996) Eur. J. Protistol. 32, 128-133[ISI].&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[6] Bermudes, D., Hinkle, G. &amp;amp; Margulis, L. (1994) Microbiol. Rev. 58, 387-400&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[7] Alberts, Bruce et. al. (1994) "Molecular Biology of the Cell", 3rd ed. pg 23-24, pg 787&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[8] Margulis, Lynn and Karlene V. Schwartz (1998) "Five Kingdoms: An Illustrated Guide to the Phyla of Life on Earth" 3rd ed. pg 10-14&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[9] Alberts (1994) pg 17-21&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[10] Ahmadjian (1986) pg 57-62&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[11] https://www.msu.edu/course/lbs/145/luckie/margulis.html&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[12]&lt;/span&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;http://www.biology.iupui.edu/biocourses/N100/2k2endosymb.html&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;[13] Rosati, Giovanna (2004) "Ectosymbiosis in Ciliated Protozoa"&lt;/span&gt;&lt;br /&gt;&lt;span style="color: rgb(0, 0, 0);"&gt;http://www.springerlink.com/content/q0759670136407t1/&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-1562002386557758976?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/1562002386557758976/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=1562002386557758976' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1562002386557758976'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1562002386557758976'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2010/02/euplotidiums-spears.html' title='Euplotidium&apos;s Spears'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/_uPFMFfHgGGg/S4r-y8vobxI/AAAAAAAAAN0/PSMS2hqWfT4/s72-c/euplotidium+1.jpg' height='72' width='72'/><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-8271614495888810702</id><published>2009-12-14T15:56:00.064-05:00</published><updated>2009-12-19T16:10:27.530-05:00</updated><title type='text'>How Life Cycles and Genetics Helps Organisms Survive In a Complex World</title><content type='html'>&lt;span style="font-size:130%;"&gt;The world is a very complicated place and it is changing all the time. It's got forests and mountains and streams and ponds and oceans and thunderstorms and winter and droughts and even ice ages and volcanoes. Fossils suggest that creatures have been living on this earth throughout three and a half billion years, generation after generation of creatures. And many of them have gone extinct but obviously not all of them because we are still here along with 2million other species of life.&lt;br /&gt;&lt;br /&gt;How does life manage to adapt to all the environments of ear&lt;/span&gt;&lt;span style="font-size:130%;"&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_0"&gt;th&lt;/span&gt; and all the changes that happen to these environments? By having all kinds of flexible life cycles and ways of inventing new traits! so lets learn about these.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://4.bp.blogspot.com/_uPFMFfHgGGg/SyaqE1OIxcI/AAAAAAAAAHc/QOr-H7KKl_M/s1600-h/amoeba+reproduction.jpg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 180px; height: 156px;" src="http://4.bp.blogspot.com/_uPFMFfHgGGg/SyaqE1OIxcI/AAAAAAAAAHc/QOr-H7KKl_M/s200/amoeba+reproduction.jpg" alt="" id="BLOGGER_PHOTO_ID_5415202601942173122" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;LIFE CYCLES&lt;br /&gt;&lt;br /&gt;A LIFE CYCLE is the sequence of stages from one newborn organism through it's development to an adult and then to reproduction to a new newborn offspring.. all the way back to the original form of the organism.  Some life cycles are&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/SyauB5ymFGI/AAAAAAAAAHs/uZBkjsFGGbU/s1600-h/FernLifeCycle.gif"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 286px; height: 320px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/SyauB5ymFGI/AAAAAAAAAHs/uZBkjsFGGbU/s320/FernLifeCycle.gif" alt="" id="BLOGGER_PHOTO_ID_5415206949675734114" border="0" /&gt;&lt;/a&gt;&lt;span style="font-size:130%;"&gt; simple&lt;/span&gt;&lt;span style="font-size:130%;"&gt; as in an amoeba growing bigger and then splitting in half to two smaller amoebas and then they grow bigger and split again to &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_1"&gt;repeat&lt;/span&gt; the life cycle.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;span style="font-size:130%;"&gt;Or life cycles can be really complicated, like the fern life cycle.  The adult fern sheds spores that don't grow into new ferns, instead they grow into tiny flat plants and then these plants grow sperms and eggs which mate and then grow into a new adult fern. This life cycle involves asexual reproduction, sexual reproduction which we will learn about soon.&lt;/span&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://4.bp.blogspot.com/_uPFMFfHgGGg/SyavDhMJbdI/AAAAAAAAAH0/Gn7hlpZojZQ/s1600-h/grasshopper+life+cycle.jpg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: right; cursor: pointer; width: 200px; height: 158px;" src="http://4.bp.blogspot.com/_uPFMFfHgGGg/SyavDhMJbdI/AAAAAAAAAH0/Gn7hlpZojZQ/s200/grasshopper+life+cycle.jpg" alt="" id="BLOGGER_PHOTO_ID_5415208076943388114" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;DEVELOPMENT&lt;br /&gt;In some life cycles the offspring are born like small versions of their parents and grow&lt;/span&gt;&lt;span style="font-size:130%;"&gt; up directly to look like their parents.  this is DIRECT DEVELOPMENT. Grasshoppers and amoebas do this.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;In other life cycles the offspring are born as larva, that look different than their adult parents, and they grow bigger for a while. Then at some point they go through a process of METAMORPHOSIS and they change into the adult&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/_uPFMFfHgGGg/SyawNvjwcWI/AAAAAAAAAH8/tFyHh8WBGzE/s1600-h/frog+life+cycle.jpg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 320px; height: 271px;" src="http://3.bp.blogspot.com/_uPFMFfHgGGg/SyawNvjwcWI/AAAAAAAAAH8/tFyHh8WBGzE/s320/frog+life+cycle.jpg" alt="" id="BLOGGER_PHOTO_ID_5415209352110829922" border="0" /&gt;&lt;/a&gt;&lt;span style="font-size:130%;"&gt; form of their parents. Frogs lay their eggs in ponds and the eggs hatch into tadpoles that can breath in water and eat algae. When the tadpoles get big enough they go through METAMORPHOSIS and sprout legs and grow lungs to breath air, and lose their tails and hop onto land.  in the adult stage frogs eat insects and can even travel to new ponds.&lt;br /&gt;&lt;br /&gt;Notice that metamorphosis allows a single species to live two totally different lifestyles in different environments.  very clever!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;TRAITS&lt;br /&gt;From generation to generation the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_2"&gt;offspring&lt;/span&gt; will inherit TRAITS from their parents. INHERITED TRAITS come form the parents and happen because the offspring get their GENES from their parents.  the GENES tell the offspring's bodies how to grow and behave. So you can inherit traits for eye color, hair curliness or even for certain inherited diseases.  these are different than &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_3"&gt;noninherited&lt;/span&gt; traits like being good at playing a musical instrument.  for that trait you had to learn how to play and your ability to play didn't come from your parents. Another &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_4"&gt;noninherited&lt;/span&gt; trait is &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_5"&gt;height&lt;/span&gt;, if you eat &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_6"&gt;healthier&lt;/span&gt; food than your parents did when they were growing up you might grow much taller than they did.  In truth, it is often hard to tell whether a trait is inherited or not inherited or somewhere &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_7"&gt;in between&lt;/span&gt;.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;ASEXUAL REPRODUCTION&lt;br /&gt;One part of an organism's life cycle is reproduction. The simplest kind of reproduction is ASEXUAL REPRODUCTION.  the single celled amoeba life cycle is very simple. It eats, it grows, when it gets big enough it makes sure it has at least two copies of everything in its insides and then splits in half.  each half is a nearly identical copy of the original amoeba, only half as big. The halves are often called daughter cells. Then they grow and repeat the cycle.&lt;br /&gt;&lt;br /&gt;In asexual reproduction each daughter cell inherits its traits from the original amoeba.&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/_uPFMFfHgGGg/Syax88e15dI/AAAAAAAAAIE/0pak4GQAriw/s1600-h/metaphase+chromosomes.gif"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 320px; height: 312px;" src="http://1.bp.blogspot.com/_uPFMFfHgGGg/Syax88e15dI/AAAAAAAAAIE/0pak4GQAriw/s320/metaphase+chromosomes.gif" alt="" id="BLOGGER_PHOTO_ID_5415211262545356242" border="0" /&gt;&lt;/a&gt;&lt;span style="font-size:130%;"&gt; Two different amoebas from different parents might have &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_8"&gt;different&lt;/span&gt; traits. The part of the cell that specifies what traits it will have are the CHROMOSOMES. The chromosomes are in the NUCLEUS. The GENES for all the traits are on the chromosomes. Some genes control one trait each, but usually many genes cooperate in complicated ways to control traits. The way the genes fit on the chromosomes took a lot of hard work to figure out and will be explained below in the section on meiosis.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sya0R4Sj8AI/AAAAAAAAAIU/BUG8Z3MHp1o/s1600-h/cellcycle_eng.jpg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 293px; height: 320px;" src="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sya0R4Sj8AI/AAAAAAAAAIU/BUG8Z3MHp1o/s320/cellcycle_eng.jpg" alt="" id="BLOGGER_PHOTO_ID_5415213821220614146" border="0" /&gt;&lt;/a&gt;         &lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;In asexual reproduction each daughter cell has the same inherited traits as the parent because each got identical copies of the parent's chromosomes.  when the parent cell was dividing it made exact copies of each of its chromosomes and then pulled each pair apart and positioned each copy in each half of the cell that would later split apart. This is called MITOSIS.  In this way each daughter cell now has the same number of chromosomes than&lt;/span&gt;&lt;span style="font-size:130%;"&gt; their parent.&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/_uPFMFfHgGGg/Sya3xYGXbWI/AAAAAAAAAIk/9GbAdDhvuGU/s1600-h/c+elegans+development.jpg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: right; cursor: pointer; width: 296px; height: 198px;" src="http://1.bp.blogspot.com/_uPFMFfHgGGg/Sya3xYGXbWI/AAAAAAAAAIk/9GbAdDhvuGU/s320/c+elegans+development.jpg" alt="" id="BLOGGER_PHOTO_ID_5415217660870225250" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_9"&gt;Multicellular&lt;/span&gt; organisms can also reproduce&lt;/span&gt;&lt;span style="font-size:130%;"&gt; asexually. &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_10"&gt;Multicellular&lt;/span&gt; means that instead of being one cell like the amoeba, the organism is made of many cells stuck together. &lt;/span&gt;&lt;span style="font-size:130%;"&gt;Most &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_11"&gt;multicellular&lt;/span&gt; organisms like yourself, start out out as a single egg cell. That cell divides asexually using mitosis and now the two daughter cells are identical genetically. Except instead of crawling apart like the amoebas do, they stick together and then each divides and now there are 4 cells, and then they divide again and there are 8 cells, then 16 cells and so on &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_12"&gt;until&lt;/span&gt;  trillions of cells arrange themselves to make your body. (worm developing inside its egg on above).  Since all these&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sya5oFc-KJI/AAAAAAAAAIs/cRxthwFqp1w/s1600-h/dicot-embryo-development-stages.jpeg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: left; cursor: pointer; width: 305px; height: 320px;" src="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sya5oFc-KJI/AAAAAAAAAIs/cRxthwFqp1w/s320/dicot-embryo-development-stages.jpeg" alt="" id="BLOGGER_PHOTO_ID_5415219700269197458" border="0" /&gt;&lt;/a&gt;&lt;span style="font-size:130%;"&gt; cells have to work together in the same body, it is good that they reproduce each other asexually so they all have the same inherited traits. This process of  &lt;/span&gt;&lt;span style="font-size:130%;"&gt;growing from one cell to an adult animal or plant is called DEVELOPMENT.  (Plant &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_13"&gt;embr&lt;/span&gt;&lt;/span&gt;&lt;span style="font-size:130%;"&gt;yo developing inside its seed on the left.)&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;span style="font-size:130%;"&gt;Strawberry plants are &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_14"&gt;multicellular&lt;/span&gt; organisms. A strawberry plant can grow&lt;/span&gt;&lt;span style="font-size:130%;"&gt; out and bend&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/_uPFMFfHgGGg/Sya1DD-Uj6I/AAAAAAAAAIc/gULoa6Nnxv0/s1600-h/strawberry-runners.jpg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 320px; height: 240px;" src="http://1.bp.blogspot.com/_uPFMFfHgGGg/Sya1DD-Uj6I/AAAAAAAAAIc/gULoa6Nnxv0/s320/strawberry-runners.jpg" alt="" id="BLOGGER_PHOTO_ID_5415214666170535842" border="0" /&gt;&lt;/a&gt;&lt;span style="font-size:130%;"&gt; back down and root itself in the ground and become a new plant. Since the offspring is made out of the original strawberry plant's body, all its cells have the same chromosomes as the parent and so it has all the same inherited traits as its parent does.&lt;/span&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Another reason why some organisms reproduce asexually is that they live in an environment that does not change much. So their offspring might as well be identical to them. Here's an example:&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/_uPFMFfHgGGg/SyfWgeG2HpI/AAAAAAAAAJM/vbt0TYtCKBU/s1600-h/freshwater+diatoms.jpg"&gt;&lt;img style="margin: 0pt 10px 10px 0pt; float: left; cursor: pointer; width: 300px; height: 220px;" src="http://1.bp.blogspot.com/_uPFMFfHgGGg/SyfWgeG2HpI/AAAAAAAAAJM/vbt0TYtCKBU/s320/freshwater+diatoms.jpg" alt="" id="BLOGGER_PHOTO_ID_5415532930262245010" border="0" /&gt;&lt;/a&gt;&lt;span style="font-size:130%;"&gt;Diatoms are single celled algae with finely sculpted shells, that look like little jewel boxes under the microscope.  They live in puddles and ponds, streams and oceans.  Let's talk about some living in a puddle. As long as the puddle is big enough they keep reproducing asexually so that one day there is one cell, then the next day 2, and the next day 4, and then 8 and 16, 32, 64.. how many will there be after two weeks? Since they reproduce asexually all the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_15"&gt;Diatoms&lt;/span&gt; will be identical and have the same inherited traits, which is good because they all live in the same puddle and so all need the same skills to survive.&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/_uPFMFfHgGGg/SyfW4a6Si8I/AAAAAAAAAJU/6HShUos6Fxw/s1600-h/sem+marine+diatoms.JPG"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 241px; height: 320px;" src="http://1.bp.blogspot.com/_uPFMFfHgGGg/SyfW4a6Si8I/AAAAAAAAAJU/6HShUos6Fxw/s320/sem+marine+diatoms.JPG" alt="" id="BLOGGER_PHOTO_ID_5415533341721136066" border="0" /&gt;&lt;/a&gt;  &lt;span style="font-size:130%;"&gt;[scanning electron &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_16"&gt;micrographs&lt;/span&gt; of marine diatoms at the right]&lt;/span&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;But what happens when the environment DOES change? What happens when the puddle starts to dry up? Then the offspring need to get to a new puddle or might even have to survive being dried out and wait for the next rain. If they have to go to a different puddle they might need different traits to survive in it. It might be deeper, or more sunny,  or might have a different kind of mud in it, &lt;/span&gt;&lt;span style="font-size:130%;"&gt;or it might even have creatures that eat Diatoms&lt;/span&gt;&lt;span style="font-size:130%;"&gt;. So how will the Diatoms produce offspring that are different than themselves?  This is what sexual reproduction is for.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;SEXUAL REPRODUCTION&lt;br /&gt;In SEXUAL REPRODUCTION, two cells with different traits come together, combine themselves into one big cell which will have different traits than either of its parents and then start growing again.&lt;br /&gt;&lt;br /&gt;So some of the diatoms split up to become eggs and some of them split up many times to become tiny cells that grow swimming tails called FLAGELLA and become sperms.  Sperm and eggs are called GAMETES.  Eggs are big and stay in one place so that they can store all the food the new creature will need to start off its life and sperm are small and swim so that creatures can make a lot of them and they can spread out and find eggs from a different family (to find new different traits) to mate with.&lt;br /&gt;&lt;br /&gt;So the sperm swims around looking for eggs from a different family and join with an egg to become one cell. Now it has different chromosomes than either of its parents Then it can grow into a hard round spore that can blow around in the wind and find a new puddle, or wait for the rain to make new puddles.  When it reaches that puddle the living cell breaks out and begins the life cycle all over again beginning with asexual reproduction... And it might survive in that puddle because it has new traits that it's parents didn't have.&lt;br /&gt;&lt;br /&gt;When diatom cells turn into sperm or into spores, it's a kind of metamorphosis!&lt;br /&gt;&lt;br /&gt;[note: &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_17"&gt;I'm&lt;/span&gt; actually mixing up details from a few different kinds of algae so that i can get it all in one story.]&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;CHROMOSOMES IN SEXUAL REPRODUCTION&lt;br /&gt;Fine, cells split up during asexual reproduction, then they come back together in sexual reproduction, then they split up again...  But wait!  we forgot to keep track of the&lt;/span&gt;&lt;span style="font-size:130%;"&gt; chromosomes, what are they doing?&lt;/span&gt;&lt;br /&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/_uPFMFfHgGGg/SywaFWDnhJI/AAAAAAAAALM/wIcT5FRzzG8/s1600-h/sexual+reproduction+first+try.bmp"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 320px; height: 238px;" src="http://3.bp.blogspot.com/_uPFMFfHgGGg/SywaFWDnhJI/AAAAAAAAALM/wIcT5FRzzG8/s320/sexual+reproduction+first+try.bmp" alt="" id="BLOGGER_PHOTO_ID_5416733130942284946" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;If the Diatoms did this:&lt;br /&gt;It would be good, the new offspring would have the traits of both parents, and they would be able to reproduce asexually in a new pond. The cell with two chromosomes can reproduce asexually into two identical cells.&lt;br /&gt;&lt;/span&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;But when it becomes time for sexual&lt;/span&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;reproduction again, look what happens: Some cells have one chromosom, some cells have two... Cells with one chromosome can join with cells with two chromosomes to make cells with three chromosomes.  Two cells with two chromosomes each can join to make cells with four chromosomes...  The Diatoms will end up with more and more chromosomes and each one will have a different number of them.  This will totally botch up the cells!  So sexual reproduction will have to work differently!&lt;br /&gt;&lt;br /&gt;So after the sperm and egg join, the new diatom will have a chromosome from each&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sywez3YkYuI/AAAAAAAAALU/yM3soaIoGRI/s1600-h/sexual+reproduction+second+try.bmp"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 320px; height: 201px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sywez3YkYuI/AAAAAAAAALU/yM3soaIoGRI/s320/sexual+reproduction+second+try.bmp" alt="" id="BLOGGER_PHOTO_ID_5416738328209023714" border="0" /&gt;&lt;/a&gt;&lt;span style="font-size:130%;"&gt; parent, and then they can reproduce asexually, so far so good. When it comes time make sperm and eggs to come together in sexual reproduction, the cells could split the number of chromosomes in half,    like this:&lt;br /&gt;&lt;br /&gt;Then the cells with one chromosome each can join again in sexual reproduction and make cells with two chromosomes.  This works pretty good, but in our diagram the new single chromosome cells are exactly the same as the original ones.  So no new traits are invented.  This isn't good either!  So real cells do something even more complicated.  It's called meiosis.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;HOW MEIOSIS WORKS&lt;br /&gt;So the actual way that cells reproduce sexually is as follows.  I am going to show the&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sy0S7vow3DI/AAAAAAAAANk/XjVlOncH3qM/s1600-h/mother+chromosomes.JPG"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 179px; height: 287px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sy0S7vow3DI/AAAAAAAAANk/XjVlOncH3qM/s320/mother+chromosomes.JPG" alt="" id="BLOGGER_PHOTO_ID_5417006744405597234" border="0" /&gt;&lt;/a&gt;&lt;span style="font-size:130%;"&gt; genes on each chromosome so that we can follow them.&lt;br /&gt;&lt;br /&gt;MAKING EGGS&lt;br /&gt;Suppose our mother diatom has these two chromosomes, one from each of her parents.  These are the different colored chromosomes in the diagram of the Diatom life cycle.&lt;/span&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;Each letter stands for a different gene. The genes are strung along the chromosome. Of course the chromosomes are really much longer than &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_18"&gt;I've&lt;/span&gt; shown because each chromosome could have a thousand genes. Well i bet if you really think about your whole body with all its parts and all the things you can do like digesting eggs, and singing, and breathing and growing hair you will realize that you have 1000s of traits too!&lt;br /&gt;&lt;br /&gt;Notice that the chromosomes are mostly the same with some differences. in the first position, each has the same gene A. in the second position each has a different gene B or b.&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/_uPFMFfHgGGg/SywjRuDGDDI/AAAAAAAAALs/ZbDoUbphghE/s1600-h/crossover+top+left.bmp"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 320px; height: 244px;" src="http://3.bp.blogspot.com/_uPFMFfHgGGg/SywjRuDGDDI/AAAAAAAAALs/ZbDoUbphghE/s320/crossover+top+left.bmp" alt="" id="BLOGGER_PHOTO_ID_5416743239145622578" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;First the cell makes a copy of each chromosome as if it were going to do asexual&lt;/span&gt;&lt;span style="font-size:130%;"&gt; reproduction.  My drawings will get too crowded if i show all the copies, so i won't.  Then it brings the two chromosomes (really 4) together and joins some of them at a few places (we show just one place):&lt;br /&gt;&lt;br /&gt;Then parts of the chromosomes swivel around, trade places and the breaks rejoin. (in &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_19"&gt;reality&lt;/span&gt; all 4 strands that i didn't draw can mix and match like this).&lt;/span&gt;&lt;span style="font-size:130%;"&gt;This twisting and rejoining is called CROSSOVER.&lt;/span&gt;&lt;br /&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sywkxlr-sMI/AAAAAAAAAL0/bOoTR4Lp-uw/s1600-h/crossover+top+right.bmp"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 320px; height: 259px;" src="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sywkxlr-sMI/AAAAAAAAAL0/bOoTR4Lp-uw/s320/crossover+top+right.bmp" alt="" id="BLOGGER_PHOTO_ID_5416744886168629442" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;Then the cell pulls one pair from the other pair (&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_20"&gt;I've&lt;/span&gt; only shown one of each pair)&lt;/span&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/SywmAjNBAfI/AAAAAAAAAL8/E4jNpfKJxj8/s1600-h/crossover+bottom+right.bmp"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 320px; height: 189px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/SywmAjNBAfI/AAAAAAAAAL8/E4jNpfKJxj8/s320/crossover+bottom+right.bmp" alt="" id="BLOGGER_PHOTO_ID_5416746242711552498" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;Then the cell does a mitosis step and splits the chromosomes into 2 cells (in reality&lt;/span&gt;&lt;span style="font-size:130%;"&gt; there are 4 different chromosomes and the cell splits twice to put each chromosome in each cell).  Each of these cells will become an egg.&lt;br /&gt;&lt;br /&gt;MEIOSIS is this whole clever process of bringing the chromosome pairs together, mixing and matching them and pulling them apart into separate cells called GAMETES.  Now each gamete has the same number of chromosomes as the original gametes in our pictures above and now sexual reproduction can work.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;span style="font-size:130%;"&gt;Notice that the chromosomes in each daughter cell is different than each of the chromosomes of the parent cell because of all that twisting.&lt;br /&gt;&lt;/span&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sy0O2h65dVI/AAAAAAAAAM0/ytpF5ocxQL4/s1600-h/father+crossover.JPG"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 233px; height: 320px;" src="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sy0O2h65dVI/AAAAAAAAAM0/ytpF5ocxQL4/s320/father+crossover.JPG" alt="" id="BLOGGER_PHOTO_ID_5417002256777704786" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;MAKING SPERM&lt;br /&gt;The male diatom will do the same thing, but to produce lots of swimming sperm first he will do many asexual reproduction steps to fill up his shell with lots of little cells. Then each of these will do meiosis steps, but each one will do the crossover at a different place in the chromosomes and each of the 100s of sperms will come out different.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;FERTILIZATION&lt;br /&gt;Finally the sperm swims around and finds an egg and they combine together into a&lt;/span&gt;&lt;span style="font-size:130%;"&gt; new big cell called the zygote or fertilized egg.  and that&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sy0SpGnGXII/AAAAAAAAANc/VGrHlU18W4Y/s1600-h/offspring+chromos.JPG"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 208px; height: 299px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sy0SpGnGXII/AAAAAAAAANc/VGrHlU18W4Y/s320/offspring+chromos.JPG" alt="" id="BLOGGER_PHOTO_ID_5417006424155118722" border="0" /&gt;&lt;/a&gt;&lt;span style="font-size:130%;"&gt; cell will again have a pair of each chromosome. Egg AbcDEFG combines with sperm abc'DEfG.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;span style="font-size:130%;"&gt;Finally we've got the whole sexual reproduction life cycle to work. Check out this diagram for the Diatom life cycle.  click on it to make it larger.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;br /&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sy1ACpQAMVI/AAAAAAAAANs/PmF2-EPkV_w/s1600-h/diatom+life+cycle+detailed+with+narration.JPG"&gt;&lt;img style="margin: 0px auto 10px; display: block; text-align: center; cursor: pointer; width: 400px; height: 291px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sy1ACpQAMVI/AAAAAAAAANs/PmF2-EPkV_w/s400/diatom+life+cycle+detailed+with+narration.JPG" alt="" id="BLOGGER_PHOTO_ID_5417056340973465938" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;MULTICELLULAR ORGANISMS&lt;br /&gt;Multicelled organisms can also reproduce sexually by doing meiosis on some of their cells and forming single celled GAMETES, the females make eggs and the males make sperm. Then the gamete cells are the ones to join. When the sperm and egg join they become a fertilized egg or ZYGOTE. Then this single cell will develop into a multicelled organism as we've described way above by asexual reproduction with mitosis, and the cells sticking together.  Click on the picture below to make it larger.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sy0PLUVNowI/AAAAAAAAAM8/4TcEZCxIF-g/s1600-h/multicellular+sexual+life+cycle.JPG"&gt;&lt;img style="margin: 0px auto 10px; display: block; text-align: center; cursor: pointer; width: 400px; height: 291px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/Sy0PLUVNowI/AAAAAAAAAM8/4TcEZCxIF-g/s400/multicellular+sexual+life+cycle.JPG" alt="" id="BLOGGER_PHOTO_ID_5417002613907235586" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;Notice that cells and organisms seem to go through these alternating cycles of sexual and asexual reproduction. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;HOW TRAITS COMBINE: DOMINANT, RECESSIVE, INCOMPLETE DOMINANCE, EPISTASIS&lt;/span&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;Genes can combine in many ways to produce traits.  First we will look at the way genes that are on the same position on the chromosome can combine.&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/SyfujglCrkI/AAAAAAAAAKU/qFXzykOZluE/s1600-h/siamese_cat_pic.jpg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 320px; height: 314px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/SyfujglCrkI/AAAAAAAAAKU/qFXzykOZluE/s320/siamese_cat_pic.jpg" alt="" id="BLOGGER_PHOTO_ID_5415559370744442434" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;1) DOMINANT TRAITS AND RECESSIVE TRAITS. Black color in cats (the C gene) is dominant over the Siamese color (the ch gene). That means that if a cat has only the genes C C it would be black. If the cat has only the genes ch ch, it would have Siamese coloring, but if the cat has both, C and ch, it will still be black. So we say that black color is the DOMINANT TRAIT and Siamese color is the RECESSIVE TRAIT.&lt;br /&gt;&lt;br /&gt;This happens inside the cats cells because the C gene makes a chemical called Melanin which makes dark colors. The ch gene is defective and doesn't make melanin, so no color. If you have C and ch, the C still makes melanin. If you have ch and ch, there's no genes to make melanin.&lt;br /&gt;&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://4.bp.blogspot.com/_uPFMFfHgGGg/Sy0QdmJ6TpI/AAAAAAAAANM/vmn7enCzm3U/s1600-h/Siamese+families.JPG"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 227px; height: 400px;" src="http://4.bp.blogspot.com/_uPFMFfHgGGg/Sy0QdmJ6TpI/AAAAAAAAANM/vmn7enCzm3U/s400/Siamese+families.JPG" alt="" id="BLOGGER_PHOTO_ID_5417004027440942738" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;Another way to think about this is if a siamese cat with the genes ch ch on both&lt;/span&gt;&lt;span style="font-size:130%;"&gt; chromosomes has kittens with a black cat with the genes C C on both chromosomes. The kittens will be black and have the genes C ch because each gamete has only one chromosome, one gamete gets an C and the other gets an E, and then they join to start a kitten growing. The siamese color is recessive.&lt;br /&gt;&lt;br /&gt;But RECESSIVE TRAITS are interesting. The kittens will grow up into adults black cats with C ch genes. If two black cats with C ch genes have kittens, remember that the father's C and ch genes get separated into two gametes, and the mother's C and ch genes get separated into two gametes and remember that the gametes can combine in all sorts of ways into a fertilized egg. So some of the kittens can have the ch ch genes and be siamese again. So if one parent has a recessive trait, the children won't show that trait, but grandchildren might!&lt;br /&gt;&lt;br /&gt;2) INCOMPLETE DOMINANCE happens when neither trait is totally dominant over the other, something in between might happen.  In Carnations, the trait for red flowers (R R) blends with trait for white flowers (r r)  and you get a new color: pink (R r).&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://2.bp.blogspot.com/_uPFMFfHgGGg/SygBEtl5D1I/AAAAAAAAAKc/nylZiiL2k7s/s1600-h/incomplete+dominance.jpg"&gt;&lt;img style="margin: 0px auto 10px; display: block; text-align: center; cursor: pointer; width: 320px; height: 154px;" src="http://2.bp.blogspot.com/_uPFMFfHgGGg/SygBEtl5D1I/AAAAAAAAAKc/nylZiiL2k7s/s320/incomplete+dominance.jpg" alt="" id="BLOGGER_PHOTO_ID_5415579732382650194" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;ENVIRONMENT CAN AFFECT TRAITS&lt;br /&gt;One more thing to notice in our siamese cats.  Their faces, ears, tails and paws are black! That's because the ch gene doesn't work where the body is warm, so no melanin is made, but it works where the body is cold at the extremities and it makes melanin there.  So here is a case where the traits are not entirely specified by the genes!  The different markings aren't inherited from the parents, but depend on how the cat grows and where it lives.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;span style="font-size:130%;"&gt;BACK TO OUR PUDDLE FULL OF DIATOMS&lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sy0Rt2wMG2I/AAAAAAAAANU/S2_GeKokHQE/s1600-h/diatom+family.JPG"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 310px; height: 320px;" src="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sy0Rt2wMG2I/AAAAAAAAANU/S2_GeKokHQE/s320/diatom+family.JPG" alt="" id="BLOGGER_PHOTO_ID_5417005406285994850" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;So, one sperm combined with one egg.  Here's a picture of our Diatom family:&lt;br /&gt;&lt;br /&gt;This offspring is totally different than its parents.&lt;br /&gt;&lt;br /&gt;Mother:  A, A, D, D, E, e, C, c&lt;br /&gt;Father:  a, a, d, D', E, e, C, c'&lt;br /&gt;&lt;br /&gt;Offspring: A, a, D, D, E, E, c, c'&lt;br /&gt;&lt;br /&gt;Suppose e is the gene for the trait of soft shells that cover the Diatoms and it's dominant over E, the trait for hard shells. Then  each parent will have the dominant trait: soft shells.  But the offsping has E E so it will have the hard shells, that's different than the parents.&lt;br /&gt;&lt;br /&gt;C might be the gene for the trait for faster growing shells.  It might be dominant over c and c'.  So the parents have fast growing shells, but the offspring will have slower growing shells.&lt;br /&gt;&lt;br /&gt;GENES ON DIFFERENT POSITIONS ON THE CHROMOSOMES CAN INTERACT ALSO.&lt;br /&gt;Not only that but genes at two different positions,  A and C might combine to make new totally unpredictable traits.  Suppose A is the gene for smooth shells, and a is for rough shells.  and A is dominant over a, so the mother has smooth and father has rough.  The offspring would have smooth too (dominant) but, c' might interact with A to make spikes on the shells. Neither parent has these!&lt;br /&gt;&lt;br /&gt;This is how sexual reproduction produces offspring with totally new traits. Parents producing gametes by meiosis and then different combinations of parents coming together produce new combinations of gens. New combinations of genes can have new unpredictable traits.&lt;br /&gt;&lt;/span&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;br /&gt;TO SUM UP.&lt;br /&gt;Notice all the different forms that organisms can take: metamorphosis, eggs, sperm, spores, haploid, diploid. Notice all the different kinds of life cycles: asexual, sexual, alternation between asexual and sexual... And there are even dominant, recessive and incompletely&lt;/span&gt;&lt;span style="font-size:130%;"&gt; dominant traits...  All these combinations make organisms  incredibly flexible and creative in their abilities to adapt to their changing environments! &lt;/span&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/_uPFMFfHgGGg/SyxOl1unEoI/AAAAAAAAAMk/0EhUBakdafA/s1600-h/Elusive_to_Angela_152.jpg"&gt;&lt;img style="margin: 0px auto 10px; display: block; text-align: center; cursor: pointer; width: 320px; height: 222px;" src="http://1.bp.blogspot.com/_uPFMFfHgGGg/SyxOl1unEoI/AAAAAAAAAMk/0EhUBakdafA/s320/Elusive_to_Angela_152.jpg" alt="" id="BLOGGER_PHOTO_ID_5416790863804568194" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:130%;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-8271614495888810702?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/8271614495888810702/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=8271614495888810702' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8271614495888810702'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8271614495888810702'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/12/world-is-very-complicated-place-and-it.html' title='How Life Cycles and Genetics Helps Organisms Survive In a Complex World'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/_uPFMFfHgGGg/SyaqE1OIxcI/AAAAAAAAAHc/QOr-H7KKl_M/s72-c/amoeba+reproduction.jpg' height='72' width='72'/><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-8631236332735495764</id><published>2009-12-13T20:23:00.005-05:00</published><updated>2010-10-06T17:59:22.648-05:00</updated><title type='text'>Narration For DNA Wrapping and Copying Video</title><content type='html'>&lt;a href="http://www.youtube.com/watch?v=Pj9cdVeIntY"&gt;.&lt;/a&gt;&lt;br /&gt;.&lt;br /&gt;&lt;a href="http://www.youtube.com/watch?v=Pj9cdVeIntY"&gt;here is the video from youtube&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;here is the narration:&lt;br /&gt;&lt;br /&gt;0:11 seconds&lt;br /&gt;so here we have a double string of  nucleotide beads  that spirals around itself (called the DNA double helix) like an old fashioned telephone cord.  this is floating around in the cell with a negative static electric charge on it.&lt;br /&gt;&lt;br /&gt;0:24 seconds&lt;br /&gt;now proteins called histones are bumping into it.  they are positvely charged and shaped just right to stick to the DNA the right distance apart and they cause the spiral to wrap up into mini spirals that bunch up into this new strand like those lanyard thingies that you probably have made.&lt;br /&gt;&lt;br /&gt;0:49 seconds&lt;br /&gt;now the supersprial spirals again into a superduper spiral&lt;br /&gt;&lt;br /&gt;1:05 seconds&lt;br /&gt;now the superduperspiral coils up yet again into a superduperduper spiral&lt;br /&gt;&lt;br /&gt;1:12 seconds&lt;br /&gt;and that makes one of your chromosomes.  you have have 48 chromosomes and&lt;br /&gt;&lt;br /&gt;1:13 seconds&lt;br /&gt;here we see a cell reproducing itself by spliting in half.  while it does that it has to separate out two copies of each of these 46 superduperduper chromosome twists, one for each cell.&lt;br /&gt;&lt;br /&gt;[now your dna needs to be wrapped up this many times because in every one of your cells, the dna is 3 feet long!  yet it has to fit into a cell that's a 500th of an inch wide.  that's 500 cells can line up in an inch.  or about 300 cells can fit into a period.  imagine packing 3 feet of superfine thread into something so tiny!  plus you gotta keep it from getting tangled!]&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;1:50&lt;br /&gt;before that can happen though the chromosomes have to uncoil all that stuff and get copied!  now here is the gang of of CRAZY PROTEIN machines that gang up on the DNA strand and copy it.&lt;br /&gt;&lt;br /&gt;the double strand to be copied comes in from the left.&lt;br /&gt;&lt;br /&gt;remember i said the DNA is TWO strands wrapped around each other.  the trouble is one gets read left to right and the other gets read right to left, (they are opposites of each other)    so they have to get copied in OPPOSITE DIRECTIONS.  but the whole copy operation only goes forward.&lt;br /&gt;&lt;br /&gt;so the blue machine splits the strands and unravels them, the forward reading strand goes down and gets fed into  the purple and green protein machines below that add on a new strand to it to make it double again.  they add the new strand from LEFT TO RIGHT AWAY from the original double strand to be copied.  that's one copied DNA double helix that goes to one of the daughter cells.&lt;br /&gt;&lt;br /&gt;the other strand that reads backwards gets sent the right through the grey/purple protein machine ahead to the right, and it gets looped around to the back and goes up and away in the picture.&lt;br /&gt;&lt;br /&gt;the first protein machine copies the forward reading strand from left to right below, but the second purple green protein machine must copy the backwards strand from right to left but that would crash into the blue machine, so that's why the strand loops backwards first.  notice that the top machine is copying in the diraction TOWARDS the original double strand.  (opposite direction of the bottom copying machine, follow the strands) but it has to stay some distance away so it doesn't crash into the blue machine.  anyway this will become the other double strand that gests sent to the other daughter cell.&lt;br /&gt;&lt;br /&gt;1:55&lt;br /&gt;now before we met this crazy machine, the top machine had already copied some of the backwards strand further away down the strand so now the new copying operation is going to join with the second double strand that was copied some seconds ago:&lt;br /&gt;&lt;br /&gt;1:55 a new green machine comes in from the right because ..&lt;br /&gt;&lt;br /&gt;1:57&lt;br /&gt;the old backwards strand green machine is separating from the copied strand and the join is complete.  meanwhile a new green machine has come in along with the purple machine is proceeding to make a NEW LOOP to start the whole process over agaiin.&lt;br /&gt;&lt;br /&gt;2:08 is the closeup.  the forward reading strand is to the right and the backward reading strand is coming out the top and to the left is the green/puprle machine copying the other end of that loop.&lt;br /&gt;&lt;br /&gt;i think they make the video go too fast!&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-8631236332735495764?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/8631236332735495764/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=8631236332735495764' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8631236332735495764'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8631236332735495764'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/12/narration-for-cell-wrapping-and-copying.html' title='Narration For DNA Wrapping and Copying Video'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-5998184703007471571</id><published>2009-11-13T17:50:00.002-05:00</published><updated>2009-11-13T17:54:57.358-05:00</updated><title type='text'>fluffy milkweed pic came out nice through cell phone</title><content type='html'>&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sv3jrBQzgJI/AAAAAAAAAHU/ttQ-DMxWT4Q/s1600-h/fuzzy+milkweed.JPG"&gt;&lt;img style="cursor:pointer; cursor:hand;width: 400px; height: 300px;" src="http://3.bp.blogspot.com/_uPFMFfHgGGg/Sv3jrBQzgJI/AAAAAAAAAHU/ttQ-DMxWT4Q/s400/fuzzy+milkweed.JPG" border="0" alt=""id="BLOGGER_PHOTO_ID_5403725456127262866" /&gt;&lt;/a&gt;&lt;br /&gt;here's a shot of milkweeds i took on a walk last weekend through a cellphone.  i think it came out particularly well.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-5998184703007471571?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/5998184703007471571/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=5998184703007471571' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5998184703007471571'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5998184703007471571'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/11/fluffy-milkweed-pic-came-out-nice.html' title='fluffy milkweed pic came out nice through cell phone'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://3.bp.blogspot.com/_uPFMFfHgGGg/Sv3jrBQzgJI/AAAAAAAAAHU/ttQ-DMxWT4Q/s72-c/fuzzy+milkweed.JPG' height='72' width='72'/><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-8818614916707220309</id><published>2009-09-21T10:01:00.004-05:00</published><updated>2009-09-21T10:57:29.242-05:00</updated><title type='text'>Supercolider Rap: Epic Poetry About Cern</title><content type='html'>&lt;object height="344" width="425"&gt;&lt;param name="movie" value="http://www.youtube.com/v/8wwozHsmVQI&amp;amp;hl=en&amp;amp;fs=1&amp;amp;"&gt;&lt;param name="allowFullScreen" value="true"&gt;&lt;param name="allowscriptaccess" value="always"&gt;&lt;embed src="http://www.youtube.com/v/8wwozHsmVQI&amp;amp;hl=en&amp;amp;fs=1&amp;amp;" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" height="344" width="425"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Now i want someone to make one about the engineering and teamwork as opposed to the theoretical physics.  that's what amazes me.&lt;br /&gt;&lt;br /&gt;more&lt;br /&gt;&lt;object height="344" width="425"&gt;&lt;param name="movie" value="http://www.youtube.com/v/MjHals9hDz0&amp;amp;hl=en&amp;amp;fs=1&amp;amp;"&gt;&lt;param name="allowFullScreen" value="true"&gt;&lt;param name="allowscriptaccess" value="always"&gt;&lt;embed src="http://www.youtube.com/v/MjHals9hDz0&amp;amp;hl=en&amp;amp;fs=1&amp;amp;" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" height="344" width="425"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;br /&gt;&lt;br /&gt;more&lt;br /&gt;&lt;br /&gt;&lt;object width="425" height="344"&gt;&lt;param name="movie" value="http://www.youtube.com/v/X_3s4D-TtxA&amp;hl=en&amp;fs=1&amp;"&gt;&lt;/param&gt;&lt;param name="allowFullScreen" value="true"&gt;&lt;/param&gt;&lt;param name="allowscriptaccess" value="always"&gt;&lt;/param&gt;&lt;embed src="http://www.youtube.com/v/X_3s4D-TtxA&amp;hl=en&amp;fs=1&amp;" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;br /&gt;&lt;br /&gt;more details&lt;br /&gt;&lt;br /&gt;&lt;object width="425" height="344"&gt;&lt;param name="movie" value="http://www.youtube.com/v/RXjR-Jkrsvg&amp;hl=en&amp;fs=1&amp;"&gt;&lt;/param&gt;&lt;param name="allowFullScreen" value="true"&gt;&lt;/param&gt;&lt;param name="allowscriptaccess" value="always"&gt;&lt;/param&gt;&lt;embed src="http://www.youtube.com/v/RXjR-Jkrsvg&amp;hl=en&amp;fs=1&amp;" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="425" height="344"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-8818614916707220309?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/8818614916707220309/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=8818614916707220309' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8818614916707220309'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8818614916707220309'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/09/supercolider-rap-epic-poetry-about-cern.html' title='Supercolider Rap: Epic Poetry About Cern'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-1592481397815674346</id><published>2009-07-29T23:06:00.002-05:00</published><updated>2009-07-29T23:12:22.697-05:00</updated><title type='text'>A Quick Crazy Intro To Genes Chromosomes and DNA</title><content type='html'>first some fun movies:&lt;br /&gt;&lt;br /&gt;chromosomes and &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_0"&gt;dna&lt;/span&gt;:&lt;br /&gt;&lt;a href="http://www.youtube.com/watch?v=Pj9cdVeIntY"&gt;http://www.youtube.com/watch?v=Pj9cdVeIntY&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;the rest of the city that a cell is:&lt;br /&gt;&lt;a href="http://www.youtube.com/watch?v=BVvvx5HGpLg"&gt;http://www.youtube.com/watch?v=BVvvx5HGpLg&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;BODIES ARE BUILT OUT OF, AND BY, INTERACTING CELLS, JUST AS NATIONS ARE BUILT OUT OF, AND BY, INTERACTING CITIES&lt;br /&gt;&lt;br /&gt;our bodies are confederations, societies, of living cells.  Some cells can live &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_1"&gt;independently&lt;/span&gt;.  For instance, sperm cells can live for a few days if given the right nutrients and temperature, other cells for instance, single celled Amoebas, and &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_2"&gt;Parameciums&lt;/span&gt; are entirely &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_3"&gt;independent&lt;/span&gt; critters that can live all by themselves in ponds.  But most of our cells are dependent on each other and stay together to make this society we call the human being.&lt;br /&gt;&lt;br /&gt;Another important fact about cells is that cells give birth to other cells.  There is no other way for living creatures to make cells from scratch. There are two ways that cells can give birth to new cells: asexual reproduction (mitosis) and sexual reproduction.  In asexual reproduction the cell copies it's insides and splits into two genetically identical halves.  now there are two living cells where there was once one.&lt;br /&gt;&lt;br /&gt;In sexual reproduction, two different cells will come together, &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_4"&gt;commingle&lt;/span&gt; their parts (genes and all) and then mix and match their genes and then separate into 4 DIFFERENT cells.  The reason for 4 and the mechanics of this complicated process i will explain later.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;You  are a society of cells that started out as a single cell colonist inside your mom's body, one fertilized egg in her fallopian tube.  This cell, this living creature, proceeded to reproduce asexually, just growing and then splitting in half and then the halves splitting in half and so on... they ate your mom's juices and held together and crawled all over each other till they built the society that was you.&lt;br /&gt;&lt;br /&gt;How did they do it? how did they know to build you and not a starfish or elephant?  It was in their genes. like this:&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;CELLS USE LIBRARIES, &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_5"&gt;BLUEPRINTS&lt;/span&gt;, PROTEINS AND PROTEIN BUILDING FACTORIES TO BUILD THEMSELVES AND FUNCTION&lt;br /&gt;&lt;br /&gt;When i said that you are a society of cells, i actually should have said that you are a nation of different cities!  Each cell is as complicated as a whole city with all kinds of roads and buildings and machines and construction workers and &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_6"&gt;decision makers&lt;/span&gt;...  Each cell/city can come to specialize in certain crafts and trade with each other in this nation that is you.  For instance red blood cells trade oxygen with the lungs and bring it to other parts of the body.  intestine cells digest food from the stomach and trade it with liver cells in return for processing of the food.  And on and on.  Our bodies have over 250 different kinds of cells all working together to make us.&lt;br /&gt;&lt;br /&gt;Each cell has a library of genes from which it copies blueprints to send out to construction sites in the cell to do all of it's construction.  the library of genes also has bulletin boards for posting notes on the current stages of construction so the thing can be coordinated.&lt;br /&gt;&lt;br /&gt;the library is in the form of 48 separate chromosomes.  each chromosome is a &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_7"&gt;superduperduperdupercoiled&lt;/span&gt; strand of DNA double helix with some complications (watch the movie of how a strand of &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_8"&gt;dna&lt;/span&gt; twists into a chromosome!)  Think of the old fashioned telephone cords.  they are a little wider than thick in cross section, almost like a ribbon, and coiled like a helix spiralled around itself.  Most of the time it gets even more twisted and &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_9"&gt;supercoils&lt;/span&gt; around itself!  The DNA strand is shaped like the phone cord, wider than thick because it's &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_10"&gt;actually&lt;/span&gt; two strands parallel to each other. &lt;br /&gt;&lt;br /&gt;each string is actually a string of beads of 4 types.  4 different kinds of Nucleotides.  A, C, G or T.    so one string looks like &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_11"&gt;AACCGTCCCTAG&lt;/span&gt;...  the other string will look like &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_12"&gt;TTGGCAGGGATC&lt;/span&gt;...  They match up; the As connecting to the Ts and the Cs connecting to the Gs to make a kind of ribbon:&lt;br /&gt;&lt;br /&gt;AT&lt;br /&gt;AT&lt;br /&gt;CG&lt;br /&gt;CG&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_13"&gt;GC&lt;/span&gt;&lt;br /&gt;TA&lt;br /&gt;CG&lt;br /&gt;CG&lt;br /&gt;CG&lt;br /&gt;AT&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_14"&gt;GC&lt;/span&gt;&lt;br /&gt;..&lt;br /&gt;..&lt;br /&gt;..&lt;br /&gt;&lt;br /&gt;and that ribbon, twists around to make the double helix.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;A sequence of these 4 types of nucleotides spells out in a kind of &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_15"&gt;Morse&lt;/span&gt; code, one specifying the sequence of amino acids to string together and make a protein.  A different sequence of amino acids makes a different protein.  So a different sequence of nucleotides  makes a different protein. This sequence of nucleotides is what is called a gene.  There are many gene sequences strung out one after another on each of these chromosomes. &lt;br /&gt;&lt;br /&gt;but each chromosome is a ribbon made of two different strings of nucleotide beads.  The blueprints that are sent to the protein making factories are called messenger RNA.  RNA is like DNA; it's also made of strings of nucleotides. But the RNA strings don't form DOUBLE &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_16"&gt;helices&lt;/span&gt;, only single strings.  Just as the two DNA strands compliment each other A for T and C for G, the RNA copy will compliment ONLY one of the DNA strands with a minor hitch: A for T and U for C, no G.&lt;br /&gt;&lt;br /&gt;so from a chromosome that looks like this:&lt;br /&gt;&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_17"&gt;AACCGTCCCTAG&lt;/span&gt;...&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_18"&gt;TTGGCAGGGATC&lt;/span&gt;...&lt;br /&gt;&lt;br /&gt;The cell will copy off an RNA blueprint like this from the top strand:  &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_19"&gt;TTUUCAUUUATC&lt;/span&gt;.&lt;br /&gt;&lt;br /&gt;are there TWO different codes on each double helix then?  Are there different genes on each strand of the double helix?  This is a good question.  Notice that the two strands compliment each other  every where on one strand where there is a T the other strand has an A, etc..  So the two strands don't really say anything DIFFERENT, if you know the sequence from one strand you can figure out the sequence opposite it on the other strand.&lt;br /&gt;&lt;br /&gt;In certain viruses, the answer to your question is YES, you can get different genes on each strand, like this:&lt;br /&gt;&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_20"&gt;AACCGTCCCTAG&lt;/span&gt;...&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_21"&gt;TTGGCAGGGATC&lt;/span&gt;...&lt;br /&gt;&lt;br /&gt;one gene might start with the second A at the top and read &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_22"&gt;ACCGTCCCTAG&lt;/span&gt;, and another gene might start at the bottom with the last C and run backwards (for reasons of the mechanics of the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_23"&gt;dna&lt;/span&gt;..)  &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_24"&gt;CTAGGGACGGTT&lt;/span&gt;...&lt;br /&gt;&lt;br /&gt;For humans, i don't know the answer.  I'll have to get back to you on that.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;The proteins are also like strings of &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_25"&gt;beeds&lt;/span&gt;.  More like chains.  Chains of different amino acids.  There are 22 different kinds of amino acids, each a different shape, each having a different kind of stickiness to the other amino acids in the chain and to the water which bathes everything in a cell.  these chains also twist and coil, depending on how the different amino acids stick to each other and interact with the water and the protein folds up into complicated shapes that either become certain building blocks, or even little dynamic machines!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;When a &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_26"&gt;blueprint&lt;/span&gt; of a gene sequence is copied and sent to a protein factory called a &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_27"&gt;ribosome&lt;/span&gt;, the workers (called transfer RNA) read the sequence off 3 nucleotides at a time: &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_28"&gt;AAC&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_29"&gt;CGT&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_30"&gt;CCC&lt;/span&gt; TAG...  For each triplet they add another amino acid to the growing chain to make a protein.  Which amino acid depends on the triplet pattern: &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_31"&gt;AAC&lt;/span&gt; might mean &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_32"&gt;leucine&lt;/span&gt;, &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_33"&gt;CGT&lt;/span&gt; might mean methionine, etc...&lt;br /&gt;&lt;br /&gt;Proteins are made of from a few hundred to a few thousand amino acids, so genes are from many hundreds to many thousands of nucleotides long.  30,000 genes on 48 chromosomes...&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;The next question is where do the genes start.  Well there are special codes for starting and stopping points.  AAA is start, &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_34"&gt;TTT&lt;/span&gt; is stop [fix this]&lt;br /&gt;&lt;br /&gt;so this strand:&lt;br /&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_35"&gt;CTACCCAAAACTAGGCGGTTTGTAACTAAACCCGCTACCTTATTTGGG&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;will have two genes: one starting AAA ACT &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_36"&gt;AGG&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_37"&gt;CGG&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_38"&gt;TTT&lt;/span&gt; and another one starting AAA &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_39"&gt;CCC&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_40"&gt;GCT&lt;/span&gt; ACT &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_41"&gt;TTA&lt;/span&gt; &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_42"&gt;TTT&lt;/span&gt;.  note there is other stuff between the genes (of course this example is abbreviated so i don't show the 100s of nucleotides for each gene).  In fact, the situation is a LOT more complicated then this!  (and you thought this was already complicated!)&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;There are 22 different kinds of amino acids and they behave very differently.  different strings of amino acid beads twist into different shapes and the amino acids interact in different ways to make each protein a very different structure.  some bind together into fibers, others make doorways in the cell, others catalyze chemical reactions and others can walk along fibers and carry things around the cell.&lt;br /&gt;&lt;br /&gt;the sequence code also tells the blueprint copiers when to start copying and when to stop and also specifies places to post bulletins about whether and when the sequence ahead or behind should be copied and how much it is currently being copied and all sorts of other things.  Things like, if the cell next door sends a message to you telling you he is next to you, that message will be posted on this &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_43"&gt;bullet en&lt;/span&gt; board somewhere... and it will effect the blueprint copiers and change which blueprints to copy at the moment.&lt;br /&gt;&lt;br /&gt;the whole thing could get rather bewildering and we don't know all the complications yet.&lt;br /&gt;&lt;br /&gt;a gene used to be what we called one sequence that stands for one blueprint to build ONE protein.  but now we know it is a little messier, sometimes we call the regions that specify where to post bulletins part of the gene.  Sometimes the blueprint copy &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_44"&gt;gets&lt;/span&gt; cut up and rearranged in different ways to make different kinds of proteins from the same gene.  the same kinds of signals that influence what's on the bulletin boards also influence how a blueprint is spliced up to make different genes.&lt;br /&gt;&lt;br /&gt;anyway this complicated &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_45"&gt;rigmarole&lt;/span&gt; actually works and  helps cells coordinate their behavior and makes them distinct from cells of other creatures.  each kind of critter has a distinct set of blueprints to direct it's activities and structures.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;actually those 46 chromosomes are actually 2 pairs of 23.  one set from each parent!  &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_46"&gt;hah&lt;/span&gt;!  you actually contain two different libraries in you at the same time.  they are pretty similar and USUALLY coordinate pretty well, in fact gives you some flexibility.  if parents who are too different try to mate, say horses and donkeys, their child will be a mule, mostly works but when THEY try to breed they find that the libraries are too different, confusion sets in and breeding &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_47"&gt;doesn't&lt;/span&gt; work.  If the parents are WAY different, say, a horse and a deer, the libraries will contain such conflicting information that the cell containing them won't even be able to function very far and make a baby.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;HOW THE SAME CHROMOSOME LIBRARY IN EACH CELL OF A CRITTER TELLS EACH CELL HOW TO BE DIFFERENT TO MAKE THE DIFFERENT ORGANS OF THE CRITTER.&lt;br /&gt;&lt;br /&gt;back to your initial cell.  when it splits into two 'daughter cells'  each has MOSTLY the same components of the original cell, but they copy the whole set of 46 strands of chromosomes into two IDENTICAL copies one per each cell.  These two daughters also split into two daughters each, and so on... Eventually the100billion  cells in your body have (MOSTLY, the differences are in the genes for the immune system, another fascinating topic!) the same sets of 46 chromosome libraries.  each cell has identical genetic information.&lt;br /&gt;&lt;br /&gt;how then does each organ come out different?  Two causes.  The original &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_48"&gt;eggcell&lt;/span&gt; actually is NOT symmetrical! When it splits into two daughters, then 4 etc... even though each daughter cell has IDENTICAL chromosome libraries, each daughter cell will differ in other cell components, various small molecules because the original egg had some components in one side different components on the other side, etc..&lt;br /&gt;&lt;br /&gt;Now the bulletin board parts of the libraries come into play.  If cell A has more molecule a than b in it, then molecule a will stick to its bulletin board and turn on gene C.  If cell B has more molecule b than a in it, then molecule b will stick on that bulletin board and turn OFF gene C&lt;br /&gt;&lt;br /&gt;Now the two cells will start functioning differently... They will have daughter cells each with identical genes from their mother cells, and having mostly the same small molecules but some different &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_49"&gt;bulletin&lt;/span&gt; board posts from their mother cells...&lt;br /&gt;&lt;br /&gt;eventually, each cell is surrounded by different kinds of cells.  now cell - cell signalling comes into play.  cells will also send signals to their neighbors that get posted on various chromosome bulletin boards.  and in this way, each cell's neighbors effect what genes that cell will be copying and using and thus cells neighboring cells will cause each other to change even more...  eventually you get an embryo growing with all kinds of different cells.  Then the different kinds of cells can tell where they are in the body, because their neighbors signal to them and thus they can form the different organs..&lt;br /&gt;&lt;br /&gt;It was important all the while, even though many different kinds of cells are forming, that the libraries are all identical.  because eventually some of these different kinds of cells, must become new eggs and sperms, and they have to have the identical libraries in them from the parents.  If the libraries, the genes themselves were all scrambled up and scribbled on with all the bulletins, the children that come from the next generation of eggs would be WAY TOO different from their parents and wouldn't make a very viable critter.&lt;br /&gt;&lt;br /&gt;so to make a new egg, all the bulletins have to be cleared off the chromosomes?  ah... that's a subtle question!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;These different when a cell finds itself in a different positions with different neighbors in your growing embryo, it begins to post different BULLETINS on the &lt;span class="blsp-spelling-error" id="SPELLING_ERROR_50"&gt;dna&lt;/span&gt; next to the appropriate genes telling the other machinery in the cell whether to use those particular blueprints or not.  eventually the different cells come to have different looking bulletin boards specifying different parts of the library that are to be read.  same library in each cell, just different cells read different books in it according to their task.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-1592481397815674346?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/1592481397815674346/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=1592481397815674346' title='3 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1592481397815674346'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1592481397815674346'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/07/quick-crazy-intro-to-genes-chromosomes.html' title='A Quick Crazy Intro To Genes Chromosomes and DNA'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>3</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-8450095388355991935</id><published>2009-07-09T08:40:00.000-05:00</published><updated>2009-07-09T08:41:44.286-05:00</updated><title type='text'>Where Does the Wealth Of Variety In Chemistry Come From?  Math!</title><content type='html'>Physical properties of substances have to do with the relocation of electrons.  Of stacking electron orbitals.&lt;br /&gt;&lt;br /&gt;So...&lt;br /&gt;&lt;br /&gt;neon starts of with 8 electrons and none in the outer shell.  neon is a quiet inert atom.  it doesn't engage in much chemistry.  Add one electron to that outer shell however and you get sodium a highly reactive metal that wants to give up that lone electron.  So Sodium cations swim in a sea of shiny malleable wandering valence electrons.&lt;br /&gt;&lt;br /&gt;Add yet another electron to the mix and we have 2 electrons in the outer shell.  anothe slightly less reactive metal, magnesium.  Add another electron to the outer shell and now we have a total new orbital and we get aluminum, less reactive and the transition from MgO a soluble opaqe soft crystal to Al2O3 a nonsoluble transparent very hard crystal: ruby.&lt;br /&gt;&lt;br /&gt;Add yet another electron and we get another orbital, silicon.  A softer metal again but it's oxide SiO4 now can form dozens of varieties of chains and rings and matrixes which give us our vast variety of minerals on Earth: quartz, feldspar, mica..&lt;br /&gt;&lt;br /&gt;Add yet another electron and we get a third orbital, phosphorus, a very reactive P4, nonmetalic spongy stuff, and PO4 cannot form stable chains at all, no vast variety of minerals, it forms instead, an acid.&lt;br /&gt;&lt;br /&gt;Add another electron, no new orbital, start filling in the old ones and we get Sulfur, S8 a harder nonreactive solid, and S02 is now a gas.  Add another electron and we get chlorine, Cl2 a highly reactive gas, and ClO is i don't know what.&lt;br /&gt;&lt;br /&gt;Add another electron and all the orbitals are full again and once again we have argon, an inert element who engages in no chemistry at all.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;To what do we owe this INTERESTING wealth of variety?  The variety of chemistry is fascinating yet not totally chaotic.  It all comes eventually from mathematics, Which is one of the recurring themes of complexity lab.&lt;br /&gt;&lt;br /&gt;The relationships between these electron orbitals are determined by their energy level, their arrangement in space.  Which are ultimately determined by the properties of solutions to a complex set of shrodinger's partial differential equations.  Solutions that make different structures in 3 dimensional space.  It would take us too far afield to explain these solutions (a few years of calcullus actually...), so we will present a simpler example: numbers.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;What could be simpler than the numbers: 1, 2, 3, 4...&lt;br /&gt;&lt;br /&gt;Lets see what happens to them every time we add one to the previous number to get the next.  Just like we added one electron at a time to our elements.&lt;br /&gt;&lt;br /&gt;1 is a unique number.  2 is the first prime number and peculiar because it is even.  3 is the first odd prime number.  4 all of a sudden is composite 2X2.  5 is prime again.  6 is now composite with TWO DIFFERENT factors 2X3.  7 is prime again. 8 is very composite 2X2X2 if we like we can consider it 3 dimensional.  The next number?  a prime again?  NO, it's composite also; 9; 3X3.  The next is composite also 10; 2X5.  8 seems to stand out as a lonely 3 dimensional number here.  11 is prime.  12 is the first example of a number with 2 different factorizations 2X6 or 3X4. Or you can call it also, 3 dimensional 2X2X3.  13 is prime again.&lt;br /&gt;&lt;br /&gt;You get the drift.  by simply adding 1 to the number we change the MULTIPLICITIVE (or geometric) properties of the numbers in unpredictable interesting ways.  This is one of the simplest examples of how mathematics can give us the spice of life, the variety in the world that we see around us.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-8450095388355991935?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/8450095388355991935/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=8450095388355991935' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8450095388355991935'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/8450095388355991935'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/07/where-does-wealth-of-variety-in.html' title='Where Does the Wealth Of Variety In Chemistry Come From?  Math!'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-4685098528517409655</id><published>2009-06-17T08:59:00.004-05:00</published><updated>2009-06-19T17:42:50.217-05:00</updated><title type='text'>References on  Newton and God</title><content type='html'>a general introduction can be found in Edward B. Davis' chapter  in the recent book:&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Galileo Goes to Jail and Other Myths about Science and Religion&lt;br /&gt;by Ronald L. Numbers&lt;br /&gt;&lt;br /&gt;In it he states that Newton was not a deist but believed it was blasphemy to think that God did not constantly interact with his creation.  He bases this on some letters between his associate Samuel Clarke, and Leibniz&lt;br /&gt;&lt;br /&gt;H. G. Alexander "the Leibniz - Clarke correspondence"  Manchester U. pr. 1956  pg 11-12, 14&lt;br /&gt;&lt;br /&gt;more info maybe here also:&lt;br /&gt;&lt;br /&gt;"God of Gods, and Lord of Lords: the theology of Isaac Newton's General Scholium to the principia" Stephen D. Snobelen, Osiris #16 (2001) pgs 169-208&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;hmm apparently Newton was a very complicated fellow.  &lt;a href="http://video.google.com/videoplay?docid=930571660745143381"&gt;here is a bbc presentation on his life&lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-4685098528517409655?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/4685098528517409655/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=4685098528517409655' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4685098528517409655'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4685098528517409655'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/06/references-on-newton-and-god.html' title='References on  Newton and God'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-7331983331321140147</id><published>2009-06-17T08:17:00.003-05:00</published><updated>2009-06-17T09:08:49.972-05:00</updated><title type='text'>What Is Newton Trying To Say About God In His Opticks?</title><content type='html'>This is from query 32 of Newton's Opticks. &lt;a href="http://www.newtonproject.sussex.ac.uk/view/texts/normalized/NATP00051"&gt; Online here:&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;In this query he has been discussing all the chemistry he knows and wondering about the laws of physics that govern the particles of matter.&lt;br /&gt;&lt;br /&gt;In it, he wonders about how the universe began, how the motions keep going given that there are inelastic collisions and friction in fluids and all motion must eventually cease.&lt;br /&gt;&lt;br /&gt;In it he has a role for God at the beginning setting it in motion intelligently.&lt;br /&gt;&lt;br /&gt;What i can't figure out from this passage is whether he has a role for God continuously prodding his creation, so it doesn't run down.  I had seen arguments that Newton thought God must be doing so or else the chaotic motions of the solar system would eventually wreck it.  these arguments are based on this passage:&lt;br /&gt;&lt;br /&gt;&lt;span style="font-style: italic;"&gt; For while Comets move in very excentrick Orbs in all manner of Positions, blind Fate could never make all the Planets move one and the same way in Orbs concentrick, some inconsiderable Irregularities excepted which may have risen from the mutual Actions of Comets and Planets upon one another, and which will be apt to increase, till this System wants a Reformation.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;from pg 378 below&lt;br /&gt;&lt;br /&gt;but i don't see that their claim is supported by this passage.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;What follows is half of query 32  broken up by me and notes inserted by me in uppercase.  ( the page numbers appear thusly: &lt;378&gt;)&lt;br /&gt;&lt;br /&gt;Notice how much Newton is thinking about and how hard it is to wrap ones head around what he is writing!&lt;br /&gt;&lt;br /&gt;&lt;a href="http://blackskimmer.blogspot.com/2009/06/references-on-newton-and-god.html"&gt;more references here&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;START HERE***&lt;br /&gt;&lt;br /&gt;And thus Nature will be very conformable to her self and very simple, performing all the great Motions of the heavenly Bodies by the Attraction of Gravity which intercedes those Bodies, and almost all the small ones of their Particles by some other attractive and repelling Powers which intercede the Particles.&lt;br /&gt;THE LAWS THUS FAR DO NOT SHOW HOW THE UNIVERSE STARTED&lt;br /&gt;The Vis inertiæ is a passive Principle by which Bo &lt;373&gt; dies persist in their Motion or Rest, receive Motion in proportion to the Force impressing it, and resist as much as they are resisted. By this Principle alone there never could have been any Motion in the World.&lt;br /&gt;&lt;br /&gt;INELASTIC COLLISIONS SHOW THAT THE MOTIONS WILL DISSIPATE&lt;br /&gt;Some other Principle was necessary for putting Bodies into Motion; and now they are in Motion, some other Principle is necessary for conserving the Motion. For from the various Composition of two Motions, 'tis very certain that there is not always the same quantity of Motion in the World. For if two Globes joined by a slender Rod, revolve about their common Center of Gravity with an uniform Motion, while that Center moves on uniformly in a right Line drawn in the Plane of their circular Motion; the Sum of the Motions of the two Globes, as often as the Globes are in the right Line described by their common Center of Gravity, will be bigger than the Sum of their Motions, when they are in a Line perpendicular to that right Line. By this Instance it appears that Motion may be got or lost.&lt;br /&gt;&lt;br /&gt;But by reason of the Tenacity of Fluids, and Attrition of their Parts, and the Weakness of Elasticity in Solids, Motion is much more apt to be lost than got, and is always upon the Decay. For Bodies which are either absolutely hard, or so soft as to be void of Elasticity, will not rebound from one another. Impenetrability makes them only stop. If two equal Bodies meet directly in vacuo, they will by the Laws of Motion stop where they meet, and lose all their Motion, and remain in rest, unless &lt;374&gt; they be elastick, and receive new Motion from their Spring. If they have so much Elasticity as suffices to make them rebound with a quarter, or half, or three quarters of the Force with which they come together, they will lose three quarters, or half, or a quarter of their Motion. And this may be tried, by letting two equal Pendulums fall against one another from equal heights. If the Pendulums be of Lead or soft Clay, they will lose all or almost all their Motions: If of elastick Bodies they will lose all but what they recover from their Elasticity. If it be said, that they can lose no Motion but what they communicate to other Bodies, the consequence is, that in vacuo they can lose no Motion, but when they meet they must go on and penetrate one anothers Dimensions.&lt;br /&gt;&lt;br /&gt;DECAY OF MOTION IN LIQUIDS DUE TO FRICTION&lt;br /&gt;If three equal round Vessels be filled, the one with Water, the other with Oil, the third with molten Pitch, and the Liquors be stirred about alike to give them a vortical Motion; the Pitch by its Tenacity will lose its Motion quickly, the Oil being less tenacious will keep it longest, but yet will lose it in a short time.&lt;br /&gt;LOSS OF MOTION IN THE HEAVENS?&lt;br /&gt;Whence it is easy to understand, that if many contiguous Vortices of molten Pitch were each of them as large as those which some suppose to revolve about the Sun and fix'd Stars, yet these and all their Parts would, by their tenacity and stiffness, communicate their Motion to one another till they all rested among themselves. Vortices of Oil or Water, or some fluider Matter, might &lt;375&gt; continue longer in Motion; but unless the Matter were void of all Tenacity and Attrition of Parts, and Communication of Motion, (which is not to be supposed) the Motion would constantly decay.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;IF DECAY, THEN MOTION MUST BE RECRUITED BY ACTIVE PRINCIPLES:&lt;br /&gt;Seeing therefore the variety of Motion which we find in the World is always decreasing, there is a necessity of conserving and recruiting it by active Principles, such as are the cause of Gravity, by which Planets and Comets keep their Motions in their Orbs, and Bodies acquire great Motion in falling;&lt;br /&gt;&lt;br /&gt;and the cause of Fermentation, by which the Heart and Blood of Animals are kept in perpetual Motion&lt;br /&gt;and Heat; the inward Parts of the Earth are constantly warm'd, and in some places grow very hot; Bodies burn and shine, Mountains take fire, the Caverns of the Earth are blown up, and the Sun continues violently hot and lucid, and warms all things by his Light. For we meet with very little Motion in the World, besides what is owing to these active Principles. And if it were not for these Principles the Bodies of the Earth, Planets, Comets, Sun, and all things in them would grow cold and freeze, and become inactive Masses; and all Putrefaction, Generation, Vegetation and Life would cease, and the Planets and Comets would not remain in their Orbs.&lt;br /&gt;&lt;br /&gt;I DON'T UNDERSTAND, HOW CAN GRAVITY BE AN ACTIVE PRINCIPLE?  IT'S NOT A SOURCE OF ENERGY!  NEWTON IS CONFUSED.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;GOD CREATED HARD PARTICLES IN THE BEGINING.  SINCE THE NATURE OF WATER CANNOT CHANGE IN TIME, THESE PARTICLES WHICH GIVE IT PROPERTIES ARE NONDESTRUCTIBLE: ATOMS&lt;br /&gt;All these things being consider'd, it seems probable to me, that God in the Beginning form'd Matter in solid, massy, hard, impenetrable, moveable Particles, of such Sizes and Figures, and with such other Properties, and in such Proportion &lt;376&gt; to Space, as most conduced to the End for which he form'd them; and that these primitive Particles being Solids, are incomparably harder than any porous Bodies compounded of them; even so very hard, as never to wear or break in pieces: No ordinary Power being able to divide what God himself made one in the first Creation. While the Particles continue entire, they may compose Bodies of one and the same Nature and Texture in all Ages: But should they wear away, or break in pieces, the Nature of Things depending on them, would be changed. Water and Earth composed of old worn Particles and Fragments of Particles, would not be of the same Nature and Texture now, with Water and Earth composed of entire Particles, in the Beginning. And therefore that Nature may be lasting, the Changes of corporeal Things are to be placed only in the various Separations and new Associations and Motions of these permanent Particles; compound Bodies being apt to break, not in the midst of solid Particles, but where those Particles are laid together, and only touch in a few Points.&lt;br /&gt;&lt;br /&gt;It seems to me farther, that these Particles have not only a Vis inertiæ, accompanied with such passive Laws of Motion as naturally result from that Force, but also that they are moved by certain active Principles, such as is that of Gravity, and that which causes Fermentation, and the Cohesion of Bodies.&lt;br /&gt;These Principles I consider not as occult Qualities, supposed to result from the specifick Forms of Things, but &lt;377&gt; as general Laws of Nature, by which the Things themselves are form'd: their Truth appearing to us by Phænomena, though their Causes be not yet discover'd.&lt;br /&gt;&lt;br /&gt;For these are manifest Qualities, and their Causes only are occult.&lt;br /&gt;&lt;br /&gt;WHAT'S HE MEAN BY OCCULT MERELY HIDDEN AS OPPOSED TO MANIFEST?&lt;br /&gt;&lt;br /&gt;And the Aristotelians gave the Name of occult Qualities not to manifest Qualities, but to such Qualities only as they supposed to lie hid in Bodies, and to be the unknown Causes of manifest Effects: Such as would be the Causes of Gravity, and of magnetick and electrick Attractions, and of Fermentations,&lt;br /&gt;&lt;br /&gt;if we should suppose that these Forces or Actions arose from Qualities unknown to us, and uncapable of being discovered and made manifest.&lt;br /&gt;&lt;br /&gt;Such occult Qualities put a stop to the Improvement of natural Philosophy, and therefore of late Years have been rejected. To tell us that every Species of Things is endow'd with an occult specifick Quality by which it acts an produces manifest Effects, is to tell us nothing:&lt;br /&gt;&lt;br /&gt;But to derive two or three general Principles of Motion from Phænomena, and afterwards to tell us how the Properties and Actions of all corporeal Things follow from those manifest Principles, would be a very great step in Philosophy, though the Causes of those Principles were not yet discover'd: And therefore I scruple not to propose the Principles of Motion above mention'd, they being of very general Extent, and leave their Causes to be found out.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;THE UNIVERSE WAS CREATED BY AN INTELLIGENT AGENT NOT BY LAWS OUT OF CHANCE CHAOS&lt;br /&gt;Now by the help of these Principles, all material Things seem to have been composed of &lt;378&gt; the hard and solid Particles above mention'd, variously associated in the first Creation by the Counsel of an intelligent Agent.&lt;br /&gt;&lt;br /&gt;For it became him who created them to set them in order.&lt;br /&gt;&lt;br /&gt;And if he did so, it's unphilosophical to seek for any other Origin of the World, or to pretend that it might arise out of a Chaos by the mere Laws of Nature;&lt;br /&gt;&lt;br /&gt;though being once form'd, it may continue by those Laws for many Ages.&lt;br /&gt;&lt;br /&gt;IT LOOKS LIKE CHAOS OUT THERE IN THE COMETS SO HOW COULD THE PLANETS COME TO MOVE ALL IN ONE DIRECTION CONCENTRIC BY LAWS FROM CHAOS?&lt;br /&gt;For while Comets move in very excentrick Orbs in all manner of Positions, blind Fate could never make all the Planets move one and the same way in Orbs concentrick, some inconsiderable Irregularities excepted which may have risen from the mutual Actions of Comets and Planets upon one another, and which will be apt to increase, till this System wants a Reformation.&lt;br /&gt;&lt;br /&gt;NO STATEMENT THOUGH THAT THIS IS WHAT will HAPPEN AND GOD MUST CONTINUE TO FIX IT.  HMMM*****&lt;br /&gt;&lt;br /&gt;Such a wonderful Uniformity in the Planetary System must be allowed the Effect of Choice.&lt;br /&gt;&lt;br /&gt;SO TOO IT'S OBVIOUS THE CONTRIVANCES OF ANIMALS ARE DESIGNED&lt;br /&gt;And so must the Uniformity in the Bodies of Animals, they having generally a right and a left side shaped alike, and on either side of their Bodies two Legs behind, and either two Arms, or two Legs, or two Wings before upon their Shoulders, and between their Shoulders a Neck running down into a Back-bone, and a Head upon it; and in the Head two Ears, two Eyes, a Nose, a Mouth and a Tongue, alike situated. Also the first Contrivance of those very artificial Parts of Animals, the Eyes, Ears, Brain, Muscles, Heart, Lungs, Midriff, Glands, Larynx, Hands, Wings, Swimming Bladders, na &lt;379&gt; tural Spectacles, and other Organs of Sense and Motion; and the Instinct of Brutes and Insects,&lt;br /&gt;&lt;br /&gt;can be the effect of nothing else than the&lt;br /&gt;&lt;br /&gt;Wisdom and Skill of a powerful&lt;br /&gt;&lt;br /&gt;ever-living Agent, who being in all Places, is more able by his Will to move the Bodies within his boundless uniform Sensorium, and thereby to&lt;br /&gt;&lt;br /&gt;form and reform the Parts of the Universe,&lt;br /&gt;&lt;br /&gt;than we are by our Will to move the Parts of our own Bodies.&lt;br /&gt;&lt;br /&gt;IS HE SAYING HERE THAT THE AGENT IS continuously REFORMING THE PARTS, EACH GENERATION OR SOMETHING?&lt;br /&gt;&lt;br /&gt;And yet we are not to consider the World as the Body of God, or the several Parts thereof, as the Parts of God. He is an uniform Being, void of Organs, Members or Parts, and they are his Creatures subordinate to him, and subservient to his Will;&lt;br /&gt;&lt;br /&gt;and he is no more the Soul of them, than the Soul of a Man is the Soul of the Species of Things carried through the Organs of Sense into the place of its Sensation, where it perceives them by means of its immediate Presence, without the Intervention of any third thing.&lt;br /&gt;&lt;br /&gt;THIS IS PUZZLING.   HE IS TRYING TO FIGURE OUT so MUCH.&lt;br /&gt;&lt;br /&gt;The Organs of Sense are not for enabling the Soul to perceive the Species of Things in its Sensorium, but only for conveying them thither; and God has no need of such Organs, he being every where present to the Things themselves. And since Space is divisible in infinitum, and Matter is not necessarily in all places, it may be also allow'd that God is able to create Particles of Matter of several Sizes and Figures, and in several Proportions to Space, and perhaps of different Densities and Forces, and thereby to vary the Laws of Nature, and make Worlds of several sorts in &lt;380&gt; several Parts of the Universe. At least, I see nothing of Contradiction in all this.&lt;br /&gt;&lt;br /&gt;As in Mathematicks, so in Natural Philosophy, the Investigation of difficult Things by the Method of Analysis, ought ever to precede the Method of Composition. This Analysis consists in making Experiments and Observations, and in drawing general Conclusions from them by Induction, and admitting of no Objections against the Conclusions, but such as are taken from Experiments, or other certain Truths. For Hypotheses are not to be regarded in experimental Philosophy. And although the arguing from Experiments and Observations by Induction be no Demonstration of general Conclusions; yet it is the best way of arguing which the Nature of Things admits of, and may be looked upon as so much the stronger, by how much the Induction is more general. And if no Exception occur from Phænomena, the Conclusion may be pronounced generally. But if at any time afterwards any Exception shall occur from Experiments, it may then begin to be pronounced with such Exceptions as occur. By this way of Analysis we may proceed from Compounds to Ingredients, and from Motions to the Forces producing them; and in general, from Effects to their Causes, and from particular Causes to more general ones, till the Argument end in the most general. This is the Method of Analysis: And the Synthesis consists in assuming the Causes discover'd and establish'd as Principles, and by them explaining the Phæ &lt;381&gt; nomena proceeding from them, and proving the Explanations.&lt;br /&gt;&lt;br /&gt;In the two first Books of these Opticks, I proceeded by this Analysis to discover and prove the original Differences of the Rays of Light in respect of Refrangibility, Reflexibility, and Colour, and their alternate Fits of easy Reflexion and easy Transmission, and the Properties of Bodies, both opake and pellucid, on which their Reflexions and Colours depend. And these Discoveries being proved, may be assumed in the Method of Composition for explaining the Phænomena arising from them: An Instance of which Method I gave in the End of the first Book. In this third Book I have only begun the Analysis of what remains to be discover'd about Light and its Effects upon the Frame of Nature, hinting several things about it, and leaving the Hints to be examin'd and improved by the farther Experiments and Observations of such as are inquisitive. And if natural Philosophy in all its Parts, by pursuing this Method, shall at length be perfected, the Bounds of moral Philosophy will be also enlarged. For so far as we can know by natural Philosophy what is the first Cause, what Power he has over us, and what Benefits we receive from him, so far our Duty towards him, as well as that towards one another, will appear to us by the Light of Nature. And no doubt, if the Worship of false Gods had not blinded the Heathen, their moral Philosophy would have gone farther than to the four Cardinal Virtues; and &lt;382&gt; instead of teaching the Transmigration of Souls, and to worship the Sun and Moon, and dead Heroes, they would have taught us to worship our true Author and Benefactor.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-7331983331321140147?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/7331983331321140147/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=7331983331321140147' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7331983331321140147'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7331983331321140147'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/06/what-is-newton-trying-to-say-about-god.html' title='What Is Newton Trying To Say About God In His Opticks?'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-637954312875493241</id><published>2009-05-04T17:22:00.001-05:00</published><updated>2009-05-04T17:24:07.004-05:00</updated><title type='text'>Atheist Vs Theist World View</title><content type='html'>silly labels, eh?  realize that atheism is NOT one cohesive tradition. there is probably an authoritative book on the nature of the banana.  there is probably NOT one on the nature of not-bananas.  atheism is NOT a single tradition.  and all of my answers are my own.  atheists only have ONE thing in common:&lt;br /&gt;&lt;br /&gt;that there can't possibly be a being something like a human mind that created the universe and Earth and all the critters and man and is inordinately fond of mankind in particular and has a plan for mankind and earth of punnishment and reward.  and that this being can be communicated with unambiguously.  Certainly no mind like being in control of the universe wrote us a book in a hman language.  that's it.&lt;br /&gt;&lt;br /&gt;and even that is questionable because what's this mean "something like a human mind"  surely some think that the evolving earth is SOMEthing like the human mind since the human mind might ALSO work by a process of overproduction of varying 'thoughts' and a 'natural selection' of them.  Who knows?  we don't know how the mind works yet.  and still these people might call themselves atheists.  there is no arbitor of who can and cannot call themselves atheists.&lt;br /&gt;&lt;br /&gt;so these answers are my own.  and i am not sure i would call myself an atheist, because we don't know how minds work, therefore, even if there was a deity, i don't know how it would work.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;There are the basic world view questions:&lt;br /&gt;1) Origins: Where did life originate&lt;br /&gt;&lt;br /&gt;This is the exciting advanture that science is on now.  is life as we know it on earth a natural consequence of chemistry?  is it rather inevitable that under cetain geochemical conditions the chemistry of CHNOPS and SiAlFeMgKCaNaCl  spontaneously forms into life?&lt;br /&gt;&lt;br /&gt;Or is life a one time low probability event?&lt;br /&gt;&lt;br /&gt;Or is it so improbable that it had to be designed?&lt;br /&gt;&lt;br /&gt;The point is that most people don't know what we've learned in teh past 150 years.  What we've learned is that rocks and chemicals are not innert and dumb.  the gyrating 20 odd elements the earth is mostly made of are dynamic information processing subtle fuzzy machines always bouncing into each other exploring, with complex behaviors!  molecules are complex and have sublte behaviors.  they are NOT only like bricks or lego blocks.&lt;br /&gt;&lt;br /&gt;In the last 70 years we've learned the molecular nature of life.  This is utterly mindblowing knowlege, that again, has not seeped into popular culture.  Yes when you look at the molecular organization of the simplest cell, the first impression is yes, the whole shebang, the whole autopoeitic loop looks irreducibly complex.&lt;br /&gt;&lt;br /&gt;on the other hand over that same time period we've been widening the scope of our exploration of chemistry.  in school we may learn something kind of dopey like: a flame is C6H12O6 +O2--&gt;CO2 +H2O.  FAR FROM IT.  even an ordinary gas flame, CH4 and O2 burns in a complicated network of cyclic chemical reactions, reminiscent of some of those in the cell.  We've begun to explore many such cyclic reactions in chemistry that spontaneously form.  We know that many of the small molecules in cells can form spontanously in a reducing atmosphere, in fact are present in meteorites. &lt;br /&gt;&lt;br /&gt;and of course even mineral chemistry is complex.  clays, zeolites, metal sulfides...  in fact at the core of many living reactions are metal sulfides..&lt;br /&gt;&lt;br /&gt;The bottom line is, that our knowlege of all this is exploding exponentially, this is an EXCITING time for exploring this question.  the gap between non life and life is narrowing.  this is NO time to back down into a stance of "it's impossible"&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;1.5) and humanity originate?&lt;br /&gt;The question of whether humanity 'originated' is partially a mathematical one.  The record shows that between the common ancestor of us and chimps to the first records of human culture 30,000 years ago is about 5million years.  that's between a 250,000 and a million generations.  children in each generation are born slightly differently, though there may be periods where differences are higher.&lt;br /&gt;&lt;br /&gt;can we say at some point we were chimp/humans and some point human?  is there a SINGLE GENERATION where we can point to the dividing line?  This seems to me a silly idea.&lt;br /&gt;&lt;br /&gt;Unless there was a discrete bifurcation in the properties or our neural nets. (here comes the mathematical part..) Or a very fast bifurcation in the network properties of our develpmental circuits or between them and ecological circuits...&lt;br /&gt;&lt;br /&gt;We don't know.  Waht we do know is that in early eocene strata and lower we find no bones that are remotely hominid, and in upper strata we find many.  many different kinds over a  period of 5 million years and 2million in earnest.  how can 500 thousand generations of changes turn a chimp like critter into a human?  if you can't imagine that happening in 500 thousand changes.. you need to learn some biology.  learn that we are the results of analog physics helping incredibly complex cell factories interpret a discretely coded blueprint called our genes.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;2) The Problem: Why is there suffering,&lt;br /&gt;&lt;br /&gt;Because there is creativity! There is suffering because that is one way to create.  to create means to say try this, NOT that.  to not try that is to suffer, unless you can break your attachments to that.  This life involves innevitable choices.  try the Buddha way  if this bothers you.&lt;br /&gt;&lt;br /&gt;2.5) why is there sickness, and death?&lt;br /&gt;more specifically, why are humans prone to horrifying diseases, insanities, social chaos?  because if we were perfect we'd be impervious to fluctuations out of which evolution creates new beings.  we'd be impervious to fluctuations out of which our minds try out new ideas.  and finally if we were perfect, would we be lovable?  would we be human at all?&lt;br /&gt;&lt;br /&gt;Why death?  some creatures don't quite die.  but vertebrates accumulate so many diseases, wear out etc...  it's easier to have kids, start from scratch than to keep repairing, a 100 year old carcass!  Of course most critters don't have the story telling memories that we do, don't become so attached to their memories as we do, so this irks us.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;3) The Solution: What is the cure for man's suffering,&lt;br /&gt;The buddha way.&lt;br /&gt;&lt;br /&gt;or, accept it.  Judaism is one way to live with the glorious creativity of life and accept the suffering as a consequence of this creativity&lt;br /&gt;&lt;br /&gt;you mean cure for diseases?  some can be cured, more wil always evolve.  it is the way of life.  You didn't want to escape this life did you?  here is the knife, go for it.  i don't recommend it.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;3.5) esp. his existential lonliness?&lt;br /&gt;why do you want to CURE this?  isn't it one of the things that define us as humans?  we spend our lives trying to connect, trying to make meaning, trying to create before we die or set up connections to what has come before us and to who will come after.  this is the human way.  why you not like it?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Questions of Meaning and Value:&lt;br /&gt;4) How does an atheist assign meaning to human activity?&lt;br /&gt;&lt;br /&gt;same as the rest of us, if we love it, if it brings us what we love, it means something to us.  what we love is partially determined by what we are like, partially a-rational.  is this a problem?&lt;br /&gt;&lt;br /&gt;Bar, you must address the common misconception that guitar chick stated: if no god, then life has no meaning, we can plunder, there is no daddy to come home to after death all is a veil of horror, it's a pathology you must address.&lt;br /&gt;&lt;br /&gt;4.5) Is all meaning subjective, or do some activities have self-evident and objective worth and meaning. If so, what are these activities, and how to you arrive at their value?&lt;br /&gt;&lt;br /&gt;see the answers to morals&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;5) Are humans of more intrinsic value than animals? Why or why not?&lt;br /&gt;&lt;br /&gt;To other humans and some of their pets they are.  If we manage master our warlike, our apocalyptic tendancies, we may even come to be able to defend our planet against large asteroid collisions, interplanetary invasion, and even spread this Earth's life to other planets, who knows?  life and we have already spread quite spectacularly.&lt;br /&gt;&lt;br /&gt;then again in the cosmic scheme of things?  is the moon of more value than the earth?  one cannot say.  one can only say "i love earth, life, humans, and this particular human more"  it is a-rational.&lt;br /&gt;&lt;br /&gt;are humans such that they can apprehend the laws of physics and one day come to be able to CHANGE the laws of physics themselves?  I cannot imagine any way to say that's impossible in 10,000 years of continued science.  so who knows?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;6) How does an atheist determine what is moral or immoral&lt;br /&gt;&lt;br /&gt;as i said in item 1.5 there is probably no ONE definition for humanity, just as there is no ONE definition for how a mammal can live.  we have an idea that humanity is a fixed thing.  and therefore that there is a fixed moral code.  i think this is wrong.&lt;br /&gt;&lt;br /&gt;a better understanding is that there is a statistical distribution of ways to be human just as all other properties of various species are distributed and vary, and that our idea of a norm of humanity is based on the fact that some large percentage of us DO operate under the same basic root behaviors and morals.  certainly psychopaths and people with severe brain damage do not.&lt;br /&gt;&lt;br /&gt;SHOULD humanity hold to ONE norm?  that is entirely another question.  would it lead to more stability?  Do clashing norms naturally lead to an armed apocalypse destroying civilization?  Can you imagine a world society enforced to one way of life?  i think it would be hell, and would require HELL to produce.  Nazi germany, anyone?&lt;br /&gt;&lt;br /&gt;in different cultures in differnt times people think differntly about this norm.  in current amercian culture we are so attentive to this norm idea that we largely ignore the real range of humanity, we are so bent on forcing each other into a norm.&lt;br /&gt;&lt;br /&gt;7) right or wrong.&lt;br /&gt;&lt;br /&gt;right for who and when and where?  again there is a broad consensus among many people on rights and wrongs, but it's NOT UNIVERSAL.  gravity is universal.  certain laws of ecology are universal, though at any point a new biological invention like plant life on land, or insect pollination or the development of animal societies can change them.&lt;br /&gt;&lt;br /&gt;Bar you must address a specific instance like african genetal mutilation, or the hijab or nazi germany.  or feminism.  or the automobile, YOU think it's wrong.  ecologically it is.  But he's asking about kosmic ultimates.  and i'm saying it DOES depend on context.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;8) Is there any objective standard or principles?&lt;br /&gt;&lt;br /&gt;that's what i'm saying.  NO.  it's dependent on the ecological milleu.  On the current state of evolution or speciation of Homo sapiens.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Questions of Worldview:&lt;br /&gt;7. What type of government does atheistic philosophy translate into?  How does it understand the relationship between man and government?&lt;br /&gt;&lt;br /&gt;I am not aware of a single type.  Humanity is too complex to determine this i think. i think we are doomed to continual experimentation.  there are certain guidelines, such as how stable creative ecosystems work by their interactions.  We can learn how other mammal societies manage and whether some of those principles are appropriate for us or not, or whether they in fact DO operate among us and whether we WANT them to or not.&lt;br /&gt;&lt;br /&gt;again, you want one fixed answer for all time.  the evidence shows that this is NOT the way of life on this Earth.  you want a reality more cozy than it is.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;7.5)  Does it merely rely on someone else's system of thought, like the assumptions of naturalistic science?&lt;br /&gt;&lt;br /&gt;Some ONE else's?  that's silly.  government is when MANY people get together and knock out a creative agreement.  and in the scheme of things perhaps governements will come to evolve as they interact with each other.  after a few rounds of hellish war, maybe we'll learn.  has europe learned or has she collapsed? interesting.&lt;br /&gt;&lt;br /&gt;the assumptions of naturalistic science?  these arent assumptions, they are observations of how ecosystems work, how humans work.  we can base how to make governemtns partially on data of the world, partially on our own desires.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;8. How does atheism view religions and religious faith?&lt;br /&gt;&lt;br /&gt;obviously all ancient societies that we have record for have had religious civilizations.  I think this is a reaction to the way we must have suddenly (see bifurcations in (1.5) above) awakened to the immense depths and horrifically tortuous passageways of our own minds.  It has taken us a long time to get out of that nightmare, and back into this refreshing REAL world.&lt;br /&gt;&lt;br /&gt;nevertheless, since humanity is not fixed there is no ONE answer for how to live. only a norm for MOSTLY how to live.  The rest of the choices are left to what we LOVE.  and how we love is a-rational.&lt;br /&gt;&lt;br /&gt;and then there is the question of suffering.  most of us grow up naturally loving some aspects of life, becoming attached to them and suffering thereby, because all is change.  if you would like, you can define religion as a response to this.&lt;br /&gt;&lt;br /&gt;Buddha way says practice letting go of attachements and you wont suffer.  this is hard.  This is a very hard path, not many are willing to put in the work.&lt;br /&gt;&lt;br /&gt;tora way says accept the suffering, it's a necessary adjunct to creativity and individuality for humanity.  celebrate it.  this is also a hard path. very few take it.&lt;br /&gt;&lt;br /&gt;I suppose these two are close to the atheist way.&lt;br /&gt;&lt;br /&gt;the way of the cross says, suffer now, and after you die, you can escape that kind of reality.  this is an easy path, billions take it.&lt;br /&gt;&lt;br /&gt;untill we change the nature of reality, religion will be here.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;8.5) What about metaphysics? Is atheism purely materialistic and naturalistic?&lt;br /&gt;&lt;br /&gt;i don't know what those mean. what could possibly be unnatural?&lt;br /&gt;&lt;br /&gt;answer the question is atheism purely rationalistic.  ah..&lt;br /&gt;&lt;br /&gt;9)  Who are the authoritative writers/books of atheism?&lt;br /&gt;&lt;br /&gt;there is probably an authoritative book on the nature of the banana.  there is probably NOT one on the nature of not-bananas.  atheism is NOT a single tradition.  and all of my answers are my own.&lt;br /&gt;&lt;br /&gt;10)  What are the central tenets of atheism&lt;br /&gt;&lt;br /&gt;that there can't possibly be a being something like a human mind that created the universe and Eaerth and all the critters and man and is inordinately fond of mankind in particular and has a plan for mankind and earth of punnishment and reward.  and that this being can be communicated with unambiguously. Certainly no mind like being in control of the universe wrote us a book in a hman language.  that's it.&lt;br /&gt;&lt;br /&gt;what are the central tenets to MY view of life?  oy vey.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;11) and if they have a "greatest commandment," what is it? For example, arguably, Christianity's is "Love the Lord your God with all of your heart, mind, soul and strength, and love your neighbor as yourself."&lt;br /&gt;&lt;br /&gt;again, atheism is NOT a single tradition.  perhaps you are thinking of the recent phenomenon of Dawkins, Dennet, Hitchens, Schermer..  I've not read.  Do you suppose even THEY agree?&lt;br /&gt;&lt;br /&gt;greatest commandment to me?  keep trying to do the next thing.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Questions of Revelation:&lt;br /&gt;10. What happens after we die?&lt;br /&gt;&lt;br /&gt;everyone else still alive, lives.  oh, you mean to us?  but that's the point eh?  you want to keep holding on to your life. Well, it wasn't yours to begin with, let go.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-637954312875493241?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/637954312875493241/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=637954312875493241' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/637954312875493241'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/637954312875493241'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/05/atheist-vs-theist-world-view.html' title='Atheist Vs Theist World View'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-1647538005021731781</id><published>2009-04-27T14:42:00.004-05:00</published><updated>2009-04-27T14:51:31.566-05:00</updated><title type='text'>Corn Starch Holes by Merkt, Deegan et. al. , kast55555,</title><content type='html'>&lt;object height="344" width="425"&gt;&lt;param name="movie" value="http://www.youtube.com/v/t5hcTnntkVM&amp;amp;hl=en&amp;amp;fs=1"&gt;&lt;param name="allowFullScreen" value="true"&gt;&lt;param name="allowscriptaccess" value="always"&gt;&lt;embed src="http://www.youtube.com/v/t5hcTnntkVM&amp;amp;hl=en&amp;amp;fs=1" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" height="344" width="425"&gt;&lt;/embed&gt;&lt;/object&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;from the description of this youtube entry:&lt;br /&gt;&lt;br /&gt;&lt;span class="description"&gt;I found this clip on the net some time ago and did a voice over to it...I also put Booker T. and the MG's as the soundtrack...&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;the video comes from the research &lt;a href="http://chaos.ph.utexas.edu/research/vibrated_cornstarch.htm"&gt;here&lt;/a&gt;&lt;br /&gt;&lt;span style="font-size:100%;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;span style=";font-family:Times New Roman;font-size:12;"  &gt;&lt;span style="font-size:100%;"&gt;F. Merkt, R.D.  Deegan, D. Goldman, E. Rericha, and H.L. Swinney, �Persistent holes in a fluid�,    Phys. Rev. Letters. &lt;b&gt;92 &lt;/b&gt;&lt;/span&gt;&lt;/span&gt;&lt;span style=";font-family:Times New Roman;font-size:12;"  &gt;&lt;span style="font-size:100%;"&gt;184501 (2004)&lt;/span&gt;&lt;/span&gt;&lt;span style=";font-family:Times New Roman;font-size:12;"  &gt;&lt;span style="font-size:100%;"&gt;&lt;br /&gt;&lt;br /&gt;what is it?  the fingers are self organizing structures feeding off of the vibrational energy supplied to the goop.&lt;br /&gt;&lt;br /&gt;you can youtube corn starch and water and find all sorts of fun stuff.&lt;br /&gt;&lt;br /&gt;you can make it yourself. easy.&lt;/span&gt; &lt;span style="font-size:100%;"&gt;&lt;/span&gt;&lt;br /&gt;&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-1647538005021731781?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/1647538005021731781/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=1647538005021731781' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1647538005021731781'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1647538005021731781'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/04/corn-starch-holes-by-merkt-deegan-et-al.html' title='Corn Starch Holes by Merkt, Deegan et. al. , kast55555,'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-7811030953766532250</id><published>2009-04-21T13:31:00.003-05:00</published><updated>2009-04-27T06:43:58.990-05:00</updated><title type='text'>New Intro To Complexity Lab Manual!</title><content type='html'>&lt;a href="http://complexitylabs.blogspot.com/2009/04/complexity-lab-manual.html"&gt;The new complexity lab manual.&lt;/a&gt;&lt;a href="http://complexitylabs.blogspot.com/2009/04/complexity-lab-manual.html"&gt;  &lt;/a&gt;It's coming along.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-7811030953766532250?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/7811030953766532250/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=7811030953766532250' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7811030953766532250'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7811030953766532250'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/04/new-intro-to-complexity-lab-manual.html' title='New Intro To Complexity Lab Manual!'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-2453552441728687875</id><published>2009-04-13T15:55:00.003-05:00</published><updated>2012-01-06T13:23:10.631-05:00</updated><title type='text'>My Responses to A Survey of Public Understanding of Evolution</title><content type='html'>A Survey of Public Understanding of Evolution&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&amp;gt;To the best of your understanding, and in your own words,&lt;br /&gt;please explain what evolution means.&lt;br /&gt;&lt;br /&gt;the word means to volute out of, that is for something to come (fly?) out of something.  in our context it means where do the multitudinous forms of all of us critters come from?  It looks like some kind of artwork after all.  In Humanity's youth,  the experience of our own minds was the most powerful presence around, the most surprising one at any rate.  By Shakespeare's time certainly his mind was an example of the most detailed creative process we'd ever observed, or bothered to observe.&lt;br /&gt;&lt;br /&gt;so the most logical answer to the question "were did all the forms we find on earth come from?" is: "something like a human mind"&lt;br /&gt;&lt;br /&gt;Starting in the time of Galileo, we finally began looking, paying attention to, respecting, even, what was outside our minds.  So that in the late 18th and early 19th centuries observations seemed to suggest that there was a deep geological history going on and that projecting current environmental processes backwards in time for 100s of millions of years could begin to explain the geological forms we found.&lt;br /&gt;&lt;br /&gt;In this geological record we find different forms of critters (fossils).  we find that over time, forms become extinct and new ones arise.  we also find that some classes of forms transform from one to another as we go up in time.  We also find that we don't find forms  in earlier layers than the forms they depended on.  I.e. we don't find fossil horses in layers before the earliest fossil fishes.  We don't find honeybees in layers before there were flowers.  Ecosystems change with the layers.  ..till we get to the current age with... well, by darwin's time we had found maybe 100,000 different kinds of plants and animals and fungi and other oddities.&lt;br /&gt;&lt;br /&gt;All this geology and biology stretches the imagination for what it means for something like a human mind, some being, to create all that, and in a small cozy amount of historical time.&lt;br /&gt;&lt;br /&gt;Other clues were:&lt;br /&gt;&lt;br /&gt;the odd placement of related or different species on islands.  Marsupials in australia and south america.  All those crazy finches on the galapagos islands...&lt;br /&gt;&lt;br /&gt;the fact that organisms AREN'T so well designed after all. whales have miniscule hip bones in them, some snakes have leg bones in them, we've got an appendix that gives us trouble, giraffes have this crazy recurrent laryngeal nerve that starts out in the neck right below the head at the larynx and loops all the way down to pass under the aorta in the chest and comes all the way back up to enter the larynx..&lt;br /&gt;&lt;br /&gt;The fact that under domestication organisms can be caused to vary quite a bit, like dogs, pigeons..&lt;br /&gt;&lt;br /&gt;A clue from Adam Smith.  Smith suggests that if every one pursued his own selfish economic means, the interactions in aggregate would even out, would buffet out to a stable economic system.  (doesn't work for humans, who happen to be too intelligently, craetively INSANE for such a simple system to work)&lt;br /&gt;&lt;br /&gt;And from John Malthus: populations increase exponentially and quickly outstrip the carrying capacity of the environment for them.  this means that in every generation not all critters of any kind get to grow up and have offspring.  &lt;br /&gt;&lt;br /&gt;In fact there's gonna be competition between critters for having kids.&lt;br /&gt;&lt;br /&gt;Do Darwin put this all together and came up with: &lt;br /&gt;&lt;br /&gt;Offspring are mostly like their parents, but a little different too.  And there's too many of these different offspring.  Those that inherited differences that allow them to outcompete their cohorts and have more kids in a particular environment, will more likely pass on those differences to the next generation of offspring in that environment.  various conditions will constrain this process to either weed out extraneous differences, or encourage the spread of these differences if the environment changes or subpopulations emigrate to new environments.  extinctions happen, especially to critters of intermediate character that arent as able  to compete as are the extremes, which are often more efficient at living in their particular environments.&lt;br /&gt;&lt;br /&gt;Over time this will give the results we see in the fossil record.  Sports which are seen in domestic breeding can continue to accumulate (look at the diversity of dogs or pigeons!) and ultimately result in new features.&lt;br /&gt;&lt;br /&gt;Since Darwin we've learned a lot more.  Founder effects excacerbate differences when small subpopulations leave large ones and immigrate to new environments, resulting in punctuation events in the fossil record.&lt;br /&gt;&lt;br /&gt;mutations can occur which are neutral and accumulate that way.  extinctions can be arbitrary bad luck of the draw, and large extinction events will wipe out MANY intermediate species, leaving fewer scattered species surviving that are more different than each other.  &lt;br /&gt;&lt;br /&gt;We've also realized that one of the most effective ways to have more kids is to COOPERATE with your neighbors and brothers and sisters instead of competing and thus we have wildly successful social species like wolves, ravens, penguins, honeybees and of course... ants.  Oh yeah, maybe humans?  well, we haven't even been around as long as wolves and how are we doing?  time will tell.&lt;br /&gt;&lt;br /&gt;And finally we learn that not all form comes from evolution, but the very clay that evolution gets to work with: molecular biology is fecund indeed and can produce much form by itself, from which natural selection can select.  Finally this is all possible because of mathematics...&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;So Evolution means: The interactions between simple agents who can accumulate mutations,  in large populations, over time, in complex changing environments, leads to the unpredictable extravagant creation of form that we see in the world today.  And that form is so extravagant because the clay that evolution gets to sculpt with - molecular biology played on two dozen different peculiar elements - is fecund indeed thanks to geometry and mathematics.&lt;br /&gt;&lt;br /&gt;see "complexity lab manual" for a discussion of the extravagance of this 'chemical clay' we got and how interactions between simple agents under flow of energy can lead to complex surprising subtle organization.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&amp;gt;If you accept the theory of evolution, please explain in your own words why; or if you do not accept the theory of evolution, please explain in your own words why not.&lt;br /&gt;&lt;br /&gt;Ah...  lets go over each of the hints:&lt;br /&gt;&lt;br /&gt;Geology.  how much have i observed?  Actually i've never travelled enough to get a good sense of how rock strata patterns match up over large areas and allow you to build up a deep stratigraphical collumn of time.  I've certainly seen some strata and fossils.  Not MANY.  Mostly i trust what i read in books, why?  Hold on a few paragraphs.&lt;br /&gt;&lt;br /&gt;I've certainly found fossils of critters no longer alive today, and certainly have found fossil beds of sea critters up on dry land.&lt;br /&gt;&lt;br /&gt;I do have experience with the disparity and diversity of life out there.  I've learned 500 different kinds of plants belonging to over a hundred different families in new york state.  I've learned a dozen different Asters, 30 different kinds of grasses.  once i took a walk and found 40 different kinds of mosses. I know of 22 different kinds of lichens and 22 different kinds of ants.  I've met over 200 disparate forms of life like red algae, plasmodial slime molds, mushrooms, crustose lichens, waterbears, millipedes, honeybee colonies, deer, stentor, pine trees...  I've found many kinds of rocks and minerals, and at museums... and books, yes i see that there are over 2000 different kinds of minerals that grow in maybe over 10,000 different forms and that there are easily over 10million different kinds of critters (mostly insects).  and I've seen enough geological structures.&lt;br /&gt;&lt;br /&gt;So where did it come from?  no one i've ever experienced could sculpt all that.  Makes no sense.&lt;br /&gt;&lt;br /&gt;I do know what it is like to craft mechanisms, to come up with creative solutions to problems, to edit one's work and redesign it over and over again to optimise it.  I've written complex computer programs, repaired automobiles, drawn pictures...&lt;br /&gt;&lt;br /&gt;I've seen plenty of examples that organisms are NOT optimally designed (for what, anyway?)  For instance infants at about 6mos are mentally ready to start learning to communicate with grammar.  however their larynxes (dammed larynx stuff again!) are not yet ready for speach untill about 1 and a half years old.  thus they remain frustrated for a year and cry a lot.  That's poor design, or design ON THE MOVE, depending on how you look at it.  I mean two different features are evolving at different paces!&lt;br /&gt;&lt;br /&gt;Now recently in history, humans have developed a rather well publicized and world wide sign language for the deaf, and some mothers have started to sign with their infants.  The infants love this and starting at 6 months they are less frustrated, cry less, and begin signing/talking earlier and better.  this is biological and cultural evolution happening right befor our eyes.&lt;br /&gt;&lt;br /&gt;I have bred kittens and guppies and have experience of the kind of variation that's possible in litters.&lt;br /&gt;&lt;br /&gt;The point is that the diversity and disparity of life on Earth IS extravagant but not INFINITELY so.  There appear to  be constraints.  Why are there no insects the size of wolves?  why no mammals as small as insects?  Why are the marsupials in australia and south america?  why are there birds some of which are almost reminiscent of lions, some of which are reminiscent of honeybees, but not COMPLETLY so?  They still seem to be stuck being birds.  Hummingbirds seem to WANT to become honeybees, or at least the environment would select them to be.. yet none have transparent wings, etc... &lt;br /&gt;&lt;br /&gt;If a creative mind crafted critters i would expect MORE inbetweens!  and more disparity.  1.5million animal species found so far but .7million of them are beetles and they all fall into ONLY 30 basic groups.  why not insects with 10 legs?  why not crabs with 6 legs?  why NO marine insects?  Why only insects, mammals, reptiles learned to fly?  Why do almost all land vertebrates have always 5 fingers or less?  In fact just look at the panda!  His ecological environment put selection pressure for an extra finger and look at the peculiar design it took to give him one.  had to coopt some bones from other parts of the wrist to make one.  Why is the creative process so constrained if not by descent with modification?&lt;br /&gt;&lt;br /&gt;So do i really think that such simple interactions over long periods of time can result in such stark creations as all these different plants and animals?  YES.  I've studied much computer science, mathematics, something called cellular automata, even chemistry, and have the experience that simple systems can indeed give rise to surprising complexity.  It takes a lot of study.  I've begun summarizing that study in my "Complexity Lab Manual".  You can find it by googling complexity lab, no quotes.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;But what's the REAL explanation of why i accept evolutionary biology?  Accept it AS WHAT? &lt;br /&gt;&lt;br /&gt;For starters, I grew up with it.  I grew up in the tradition of natural science.  I grew up learning, experiencing concretely more details than are to be found in all of Shakespeare and the Bible put together.    I grew up in a culture in the lower east side of manhattan that was multicultural, that was mostly a result of enlightenment Europe with a little rabbinic judaism thrown in.  But i did not grow up in an isolated shtettle.&lt;br /&gt;&lt;br /&gt;But it can't be only that.  I certainly was exposed to religious culture, read tora, but... nah.. none of those adults made a big effort to come out and say what they thought god was, or really, why should i pray and be jewish.&lt;br /&gt;&lt;br /&gt;Over the years I've met many such people both jewish, christian, buddhist, new age..  I have to admit that few if any of them have any real INTEREST in the details of critters and rocks and chemistry and mechanisms that i grew up with.  See my review of Francis Collins biographical book.  Sure, he can manage a molecular biology lab and talk the evolutionary biology lingo, even use the scientific method in limited domains of his work, maybe.  But he came from a vastly different culture than i did, and seems to still belong to that CULTURE.  &lt;br /&gt;&lt;br /&gt;I mean i can easily slip into a religious culture and do fascinating theological exegesis and enter a poetic trance and pray with people...  But it is not my home.&lt;br /&gt;&lt;br /&gt;I've had my share of ecstatic experiences, but they were out in the fields and swamps and woods either being directly in contact with nature or meditating on its complex, subtle, richly textured details.  I did not have them in church or synagogue.&lt;br /&gt;&lt;br /&gt;The third thing about this scientific culture... sure, when i read books by scientists i feel at home with them... but it's more than just a heimishe feeling.  The point is that anything these books report about the natural history that i HAVE had the opportunity to observe first hand, jives with my observations.  The point is that these guys can also shoot the breeze about how to troubleshoot cars, design computers, algorithms... things that i have done.  I have created computer systems and programs and fixed cars and other mechanisms.  I have done chemistry and pottery and grown plants...  and i do it by way of attitudes akin to the scientific method, not at all by way of prayer...&lt;br /&gt;&lt;br /&gt;I fully admit that i do not react strongly to father figures, policemen, politicians, celebrities.  Perhaps it is simply comes down to a quirk of personality.  the complex interactions between bugs and plants, between mechanical parts, rocks and chemicals is to me MORE interesting than celebrity father figures.&lt;br /&gt;&lt;br /&gt;On the other hand, my study of biology, ecology and human history suggest to me that our propensity to follow such celebrities has not led to our most endearing behaviors.  Far from it: world wars, inquisitions, crusades...  So in the balance i think that evolving ecosystems are much more creative, stable, harmonious, encouraging of human dignity than are systems created, ruled and judged by fatherkingpolicemancraftsmen&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&amp;gt;How confident are you that you understand the scientific theory of evolution?&lt;br /&gt;&lt;br /&gt;That i understand how life on earth evolves, or that i understand the current scientific understanding of it?  oops that just changed as i typed this...&lt;br /&gt;&lt;br /&gt;To the first question, i KNOW that there are things that i still don't understand at all, and that none of us do.  That's all right in the scientific culture i live in.  To the second question?  I've studied it for 30 years or more, I suppose i understand it as well as any graduate student with a firm grasp of his studies.  though because i've not had the oppurtunity to work out some details, i know i've got definite gaps.  &lt;br /&gt;&lt;br /&gt;And like i said there are major issues that i believe are unresolved.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&amp;gt;On the question of the origin and development of life and humans,&lt;br /&gt;what do you believe?&lt;br /&gt;&lt;br /&gt;that's four questions. &lt;br /&gt;&lt;br /&gt;On the development of life, we've just been discussing that.  &lt;br /&gt;&lt;br /&gt;On the origins of humans... well, mostly the same as the origins of any other species.  oh, by the way, can you define human?  if not you can't discuss it's exact origins can you?  The whole issue of species and origins is very subtle and messy.  We don't have good answers right now.  Did humanity result from a final mutation that caused a bifurcation in the dynamical system that was the behavior of the individual in which it happened in and thus in all her descendants? &lt;br /&gt;&lt;br /&gt;Or did it result from bifurcation in properties of a whole population, which then went on to grow?&lt;br /&gt;&lt;br /&gt;Or was there NO distinct origin of humanity in time on this Earth?  most likely answer.  I don't beleive you can define humanity, the only reason we are so distinct from every other critter we can see, is that the apes have always been rather flimsy low population critters frought with much extinction.  The fossil record shows many variations over the last 5million years and at some times in the past there were as many as FIVE different kinds of 'apey human critters'.  For that matter is a poor sot with the IQ of 40 a human?  Is an idiot savant mathematical genius who can't even tie his own shoes or say hello, a human?  how about a Homo or a Nigger? (I use these terms to point out that the definition of what is human is not so objective but influenced by strong emotions, especially when religion is involved)&lt;br /&gt;&lt;br /&gt;Species are not fixed, they are moving targets.  Thats one of the points of evolutionary biology.&lt;br /&gt;&lt;br /&gt;Are humans different from other living critters in ways that no other critter is different than other critters?  I've tried to argue this, but in the end i can come up with nothing that stands:&lt;br /&gt;&lt;br /&gt;"what's so special about humans.txt"&lt;br /&gt;&lt;br /&gt;On the development of humans, you mean that culture changes  everything? but plenty of critters have culture...  don't worry, humans are still evolving genetically.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;The origin of life?  Ah, my FAVORITE topic.  What do i BELIEVE?  Better, what am i excited about to explore for the rest of my life and vicariously for the rest of human history!  It is true that currently we do NOT have a clue whether life as we know it is a reasonable extrapolation of what we know of geochemistry today.  BUT:&lt;br /&gt;&lt;br /&gt;Some of us have a very strong HUNCH and not because we've been told it is so, but becuase we've put in decades of study of the topics in complexity lab:&lt;br /&gt;&lt;br /&gt;1) we are actively exploring all sorts of new chemistry experiments and finding more and more complex chemical reactions, more complex molecular structures that can form from scratch in the laboratory&lt;br /&gt;&lt;br /&gt;2) we are exploring the very molecular structure of life, and taking apart some of the molecular systems that makes life go and seeing which subsystems can work alone, and how they work together, slowly finding the simplest systems that still  have interesting complex properties of life.&lt;br /&gt;&lt;br /&gt;3) we are exploring all kinds of mathematics and computer science that shows us that when you simple mechanisms interacting repeatedly with simple rules of interaction between their neighbors, complex patterns eventually come out, sometimes even in a process similar to the one darwin proposed for evolution of forms out of simple iinteractions between creatures.&lt;br /&gt;&lt;br /&gt;4) It's not, dammit, so much as what i believe, it's that this is such exciting stuff, that i want to take part in this exploration and see what is possible.  This exploration is only SIXTY years old or so, In the history of human civilization, it is brand new.  Imagine what we will learn in the next 60 years?  Aren't you excited.&lt;br /&gt;&lt;br /&gt;Yes, my hunch is that within the next 60 years we will find out that life is a natural consequence of chemistry.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&amp;gt;rate myself on these scales:&lt;br /&gt;&lt;br /&gt;&amp;gt;a fiscal/economic conservative  -----a fiscal/economic liberal&lt;br /&gt;don't know what it means, you need both conservative and experimental elements to run a stable creative society&lt;br /&gt;&lt;br /&gt;&amp;gt;a social conservative    ------a social liberal&lt;br /&gt;still don't know what you mean, same answer.&lt;br /&gt;&lt;br /&gt;&amp;gt;not very interested in science    ------very interested in science&lt;br /&gt;very interested in science&lt;br /&gt;&lt;br /&gt;&amp;gt;not at all religious-------very religious&lt;br /&gt;sometimes religious, mystical-poetic anyway&lt;br /&gt;                &lt;br /&gt;&lt;br /&gt;&amp;gt;Do you believe there is a God?&lt;br /&gt;(a purposeful higher intelligence that created the universe)&lt;br /&gt;&lt;br /&gt;"purposeful higher intelligence"  higher than what? chihuahua?  wait, is there even a single linear scale to intelligence?  now what do we mean?  I mean what do you, some catholics, some fundamentalist protestants, some new age hipsters, some hindus....  mean the same thing by this?  The best i can do with your question is pick as concrete examples as i can:&lt;br /&gt;&lt;br /&gt;did something like human intelligence create the universe?  ummm... guess what?  we don't even know what human intelligence is, how it works, and how it is a product of it's neuronal substrate.  So can there be some kind of weird computer at the origin of the universe that's something like human intelligence that creaeted the laws of physics and flicked a switch...&lt;br /&gt;&lt;br /&gt;you ask too silly, too general a question.  why you switch from evolution of life to the whole universe?  now you have broadened dangerously your question and open up a whole new can of worms.&lt;br /&gt;&lt;br /&gt;i can certainly say that it does not seem to me that a human like intelligence created and maintains life on this earth.  Also i don't see how such an entity could have sculpted this earth out of what universe stuff there was before.&lt;br /&gt;&lt;br /&gt;now you want me to go back and discuss physics?  I'm not very well versed in it.&lt;br /&gt;&lt;br /&gt;i see no evidence of purpose in this universe though.  you can see my discussion:  How to Explore Whether the Universe Is a Loving God (Cosmological Anthropic Principle)  on blackskimmerblog.blogspot.com&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Or another example: can the whole universe be a purposeful humanelike intelligence?  We've hardly explored it have we?  like i said we don't know how human intelligence works.  Is it digital?  is it a wave phenomenon?  does it have quantum phenomena that are important?  we simply do not know. &lt;br /&gt;&lt;br /&gt;My suspicion is that the universe is not now interconnected enough to be thinking very fast.  But way way back?  since we see stars and galaxies are receeding from each other, maybe 10billion years ago or even very close to the big bang (whatever that is) the universe WAS interconnected enough to be intelligent?&lt;br /&gt;&lt;br /&gt;You ask BIG questions.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&amp;gt;On average, when you were growing up, how often did you attend religious services?&lt;br /&gt;&lt;br /&gt;pre-K to 3rd day, Hebrew day school.  I hated school i don't recall religious services.  afterwards, sometimes we did shabat services once a week.  untill my bar mitzva at age 13.  Then i was allowed to quit.  STUPID strand of religion, eh?&lt;br /&gt;&lt;br /&gt;&amp;gt;How often do you presently attend religious services?&lt;br /&gt;&lt;br /&gt;now?  rarely.  every know and then i do weekly. for instance even zen practice twice a week or more.  and there have been times when practiced religous ritual much more often, meditation, acts of appreciating this glorious life, standing with sunset, eating a meal...  These days i am not very religious.  but that's a rather personal question.&lt;br /&gt;&lt;br /&gt;&amp;gt;Current religious organization membership:&lt;br /&gt;&lt;br /&gt;Membership?  funny word!  Judaism, 'am yisro'el is my family.  a particular local unit community that i attend functions at regularly?  no.&lt;br /&gt;&lt;br /&gt;&amp;gt;What is your highest level of education?&lt;br /&gt;&lt;br /&gt;1 semester of graduate biology.  But of course i am always studying new things outside of school, very high level.&lt;br /&gt;&lt;br /&gt;&amp;gt;Gender M&lt;br /&gt;&amp;gt;Age 46&lt;br /&gt;&amp;gt;Ethnicity &lt;br /&gt;&lt;br /&gt;African Jewish Eastern European European Enlightenment Brittish Naturalist Scientist Native American Lower East Side New Yorker.&lt;br /&gt;&lt;br /&gt;You didn't want to define what you meant by ethnicity did you?  i mean, "white" is a stupid term.  i don't think "caucasian" is much more accurate either!  Neither would solely jewish be accurate.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&amp;gt;What is your country of residence?&lt;br /&gt;gave it.  New York City.  currently in exile upstate.  New York City is NOT American.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-2453552441728687875?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/2453552441728687875/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=2453552441728687875' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2453552441728687875'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2453552441728687875'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/04/my-responses-to-survey-of-public.html' title='My Responses to A Survey of Public Understanding of Evolution'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-7889470336822986627</id><published>2009-03-28T15:30:00.002-05:00</published><updated>2009-03-28T17:03:31.831-05:00</updated><title type='text'>An Example of How Science Works From George W. Corner</title><content type='html'>I got this story first from Garett Hardin's   2nd ed biology textbook.  In it George W. Corner  tells about his and W. M. Allen's  research  on progesterone in rabbits  to illustrate how science works. Note how the scientists treat their observations, their techniques, how they critique themselves and each other but how they don't give up.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;A failure and what it taught.&lt;br /&gt;&lt;br /&gt;Willard Allen and I had a&lt;br /&gt;queer experience with our first extracts, from which we learned&lt;br /&gt;something important, so that the story is not only amusing&lt;br /&gt;but useful. The beginning of this tale is that when we started&lt;br /&gt;we followed (as I said before) a hint from the work of Ed-&lt;br /&gt;mund Herrmann, who had obviously produced progestational&lt;br /&gt;proliferation in a few of his experiments without knowing it.&lt;br /&gt;He had used very young rabbits, roughly 8 weeks old. They&lt;br /&gt;react more readily than adults to the estrogen which was the&lt;br /&gt;chief ingredient of his extracts. Since we wanted to follow his&lt;br /&gt;methods closely at first, we used infant rabbits too, and with&lt;br /&gt;them our first successes were obtained. In the spring of 1929&lt;br /&gt;we were all ready to report the first steps in print. The paper&lt;br /&gt;was being written, when it occurred to me that our directions&lt;br /&gt;for extracting the hormone ought to be tried out by a none-&lt;br /&gt;too-good chemist, just to make sure they were foolproof. We&lt;br /&gt;did not want others to think our work could not be repeated,&lt;br /&gt;just because our directions were not clear. It was agreed that&lt;br /&gt;I was a bad enough chemist for the test : if I could make the&lt;br /&gt;extract all by myself, then anybody could. So Allen went on&lt;br /&gt;his vacation and I went back to our extractors and vacuum&lt;br /&gt;stills. In a week I had a batch ready; to my horror it was&lt;br /&gt;ineffectual. I made another batch; it, too, was worthless. I&lt;br /&gt;&lt;br /&gt;suppressed the paper and telegraphed for Allen. We decided&lt;br /&gt;that I needed a vacation and that we would look for the&lt;br /&gt;trouble in the fall. In September I made another batch with&lt;br /&gt;Allen watching every step, but not touching the apparatus.&lt;br /&gt;It was no good. What could be wrong.'' Since my laboratory&lt;br /&gt;was sunnier than his, perhaps my hormone was being spoiled&lt;br /&gt;by sunlight. I had a room blacked out and made a batch in&lt;br /&gt;the dark. That failed. Then we remembered that Allen, being&lt;br /&gt;a better chemist than I, usually got his extracts freer of su-&lt;br /&gt;perfluous grease and therefore had to mix them with corn oil&lt;br /&gt;(Mazola) so that he could inject them. Mine were greasy&lt;br /&gt;enough to inject without added oil. Perhaps the corn oil pro-&lt;br /&gt;tected his hormones somehow while mine spoiled. We checked&lt;br /&gt;that idea — another two weeks gone — and that was not the&lt;br /&gt;answer. Then in desperation we made a batch together, side&lt;br /&gt;by side and almost hand in hand, each watching the other. We&lt;br /&gt;divided it into two lots and tested it separately — Allen's&lt;br /&gt;worked ; mine did not ! Eureka, my trouble was in the testing,&lt;br /&gt;not in the cookery.&lt;br /&gt;&lt;br /&gt;The explanation will seem so silly that I almost hesitate&lt;br /&gt;to admit what it was. The fact is that rabbits do not respond&lt;br /&gt;well to progesterone until they are about 8 weeks old and&lt;br /&gt;weigh about 800 grams. We did not know this, and our rab-&lt;br /&gt;bits ranged from 600 to 1,200 grams. When we went to the&lt;br /&gt;cages to inject them, Willard Allen's idea of what constitutes&lt;br /&gt;a nice rabbit led him to choose the larger ones, while I must&lt;br /&gt;have had a subconscious preference for the infants. My ex-&lt;br /&gt;tracts had been as good as his all the while, but my rabbits&lt;br /&gt;were insensitive. It is staggering to think how often the success&lt;br /&gt;or failure of research may hang upon such an unimaginable&lt;br /&gt;contingency.&lt;br /&gt;&lt;br /&gt;from&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;THE HORMONES IN HUMAN REPRODUCTION&lt;br /&gt;&lt;br /&gt;by George W. Corner&lt;br /&gt;pg 118 to 119&lt;br /&gt;&lt;br /&gt;the whole book looks rather fun.&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.archive.org/stream/hormonesinhumanr00corn/hormonesinhumanr00corn_djvu.txt"&gt;read the whole book online here:&lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-7889470336822986627?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/7889470336822986627/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=7889470336822986627' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7889470336822986627'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7889470336822986627'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/03/example-of-how-science-works-from.html' title='An Example of How Science Works From George W. Corner'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-2367296904426877497</id><published>2009-03-03T07:47:00.002-05:00</published><updated>2009-03-03T07:59:54.503-05:00</updated><title type='text'>It Snowed Last Night.  Snow! What Crazy Stuff That Is!</title><content type='html'>Why does this aspect of the universe amaze me so much?  That water comes in three funky phases and how they intertransform is interesting. That Earth is a dynamic place.  The sun is warmer than outerspace and warmer than Earth so light flows from the sun to earth and warms the seas and the water in the seas is not just a continuous featureless goopy liquid it's  frenetic dance of things called molecules.   anyway these 'things' are actually rather clever, they can respond to energy and their neighbors.  give 'em energy and they can dance away from their neighbors, let 'em lose energy at night and they bump into their neighbors and stick.  water molecules are actually quite sophisticated little machines and can do some simple computations and can make interesting shapes. &lt;br /&gt;&lt;br /&gt;anyway sunlight is enough energy to launch a water molecule if it absorbs some light, then emits some light back, it will spring, and if it bounces against a neigbor fast enough it will be going fast enough to launch itself into space.  until it bounces into another air molecule also launching into space and you get a chaotic pinball game of molecules bouncing into each other that we call our atmosphere.  something we can breath.&lt;br /&gt;&lt;br /&gt;of course by the time they get pretty high, it gets colder up there and colder means they start loosing energy to the cold outerspace and if they start crashing into each other they start holding on.  if enough of them do this it's a water droplet.  water droplets though even are complex, they have distinct outsides and insides.  they float around up there, having all those faster molecules bouncing into them imparting motion to them in all different directions.  eventually though they grow big enough and gravity pulls 'em down.  that's called rain.  and of course that does all the building of streams and ponds and washing away of soil, Grand Canyons etc...&lt;br /&gt;&lt;br /&gt;but what if they get higher and get REALLY cold? then they really get a chance to slow down and 'feel' each other out.  even in water droplets they are actually bouncing around each other momentarily holding on and letting go. ( what's the dividing line microscopically between being water and being ice?  not sure really.  i think it's a matter of what percentage of them are holding on at any given time!  there's a branch of mathematics called zero one laws on random graphs that gives some results on sudden bifurcations in behavior of masses of interacting thingies given the slow increase in percentage of connections...)  so it turns out that at a certain temperature, water freezes.  but not microscopically!  at the surface of the growing crystal there is no such thing as temperature!  and many curious things can happen, many dynamic things can happen.  and they do!  and the water molecules dance delicately back and forth together back into the air and sculpt themselves into... snowflakes!  so curious that each one is a unique sculpture.&lt;br /&gt;&lt;br /&gt;it is a tribute to the dynamic sensitive nature of these molecule thingies that ice does not ONLY come down in tiny featureless blobs, but often comes down as snow.  and funny stuff snow is.  it's feathery but eventually it does succumb to gravity's pull and eventually falls and piles up on Earth.  because it is so feathery it reflects white, and because snowflakes are feathery they catch on each other higgledy piggledy and snow is fluffy.  it's also a good insulator, catching air pockets...&lt;br /&gt;&lt;br /&gt;it is a tribute to the 'intelligence' of these little molecules that at different temperatures and climatic conditions they can make moisture in the air, that's pleasant, or they can condense and make a dynamic fluid we can swim in!  and they can tell they are at the edge of their fluid and they hold on REALLY tight there and little bugs can walk around on that!  if they slowly freeze at the top of the pond then you can go iceskating on it!  because the pressure of your iceskate blades makes it melt again momentarily and the water makes a good lubricant!  if the moisture in the air freezes more delicately it comes down as snow and kids can jump into it and roll down the hills in it, it's soft enough to break their fall due to a complicated interaction between millions of quickly snapping snowflake arms...  the simplest physical system, only water cooling - already makes complex structures with fascinating functionality.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;snow molecules are things?  if the things can respond to each other and make connections and separate etc... do you call 'em things?  if they can sense whether they are at the edge or the middle of a pile of themselves because of their connections do we call them things or machines or what's the dividing line between a thing and an animate being.  forget about reproduction most animate beings right now ain't reproducing.  I want to explore the fundamental nature of animate beings, break the concept down into its components.  What are the multiple properties that make beings animate?  I think the properties are well distributed into all the parts, and then built up from interactions between parts, between parts that are capable of interacting.&lt;br /&gt;&lt;br /&gt;see, many people are fond of pointing out that a pile of boeing 747 parts in a heap would never come together to make an aeroplane.  they are "dead inert matter".  And by anology a pile of chemicals could never spontaneously come together and become a living being.  But this is a faulty analogy due to our perception of size scale and time.  of course as time goes on they WILL interact (NOT inert at all) with the rain and the oxygen and begin to rust.  sand will blow against them and the rust will eventuall break off, they will eventually crumble and the rust will eventually wash away into the soil where it will dissolve into individual ions and the ions at the level of ions are certainly NOT inert dead parts, but active sensitive little critters that will get into all sorts of dynamic combinations and can even catalyze other dynamic combinations, similar to the ones that power US.&lt;br /&gt;&lt;br /&gt;But at our scale of time and space, Boeing parts do not interact.  But ont he scale of molecules, molecules CERTAINLY are capable of interacting, getting cought up in networks of interactions that are creative... I want to show that the ground of being of the universe, is not lumpish, inert, like clay, but dynamic, responsive, containing the 'microscopic components' so to speak, of creativity.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-2367296904426877497?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/2367296904426877497/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=2367296904426877497' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2367296904426877497'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2367296904426877497'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/03/it-snowed-last-night-snow-what-crazy.html' title='It Snowed Last Night.  Snow! What Crazy Stuff That Is!'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-1812231814420389197</id><published>2009-02-19T09:40:00.005-05:00</published><updated>2009-03-28T17:06:45.545-05:00</updated><title type='text'>What Is Science, And Why Is It An Important Part Of My Outlook On Life?</title><content type='html'>i'd like to point some things about science as  a way of knowing, loving forming a mature relationship with reality.&lt;br /&gt;&lt;br /&gt;1) it is a way for a community of men, women, other animals and mechanical instruments who want to join in to learn to discuss civilly with each other, to learn to give and take constructive criticism, to take the responsibility to catch themselves and each other when the mind is tricking us, or we mess up on an observation or someting both trivial and profound.  &lt;a href="http://blackskimmer.blogspot.com/2009/03/example-of-how-science-works-from.html"&gt;read a story about this here&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;2) it is grown out of a love the details we find ourselves surrounded by: rocks, bugs, worms, clouds, mud, light, planets, bubbles.. and out of this love scientists have explored EVERY nook and cranny, no matter how small, inconsequential, smelly, unpleasant... they are to most people.  The incredible advances we have in genetics and development came about because some scientists decided to look at WORMS and GRUBS.  (Caenorhabditis elegans, Drosophila melanogaster)&lt;br /&gt;&lt;br /&gt;2) it is a way to LOVE reality. in a mature fashion, not just romantic falling in love, but doing the hard work to get to know reality on it's own terms even if those contradict our preconceptions, our fears, our desires.  Requires getting outside of our heads, outside of our preconceptions of what we'd like the universe to be like. requires hard work of really listening to what our lover is saying to us.&lt;br /&gt;&lt;br /&gt;4) we've explored a LOT.  Scientists over the past 400 years, by way of egging each other on and record keeping andwondering and  imagining and crafting instruments has explored more than anyone could have imagined.  Just peruse this &lt;a href="http://blackskimmer.blogspot.com/2009/02/topics-for-highschool-science-about.html"&gt;summary of 1600 topics for high school science&lt;/a&gt; and see how much science has spread out across the world of phenomena. Notice the depth and breadth of that exploration. Notice these are topics for high school or freshman science in college. This list can easily be expanded in depth a hundred fold, and in breadth to many more realms of basic physics, cosmology, and biochemistry...&lt;br /&gt;&lt;br /&gt;5) those hundreds of thousands of facts and formulas and theories in hundreds of disparate realms of experience are not just ISOLATED facts.  They JIVE WITH EACH OTHER. they reinforce each other, the body of knowlege that science has gained is a cohesive whole.&lt;br /&gt;&lt;br /&gt;I'll post some more about this remarkable cohesivity soon.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-1812231814420389197?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/1812231814420389197/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=1812231814420389197' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1812231814420389197'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/1812231814420389197'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/02/what-is-science-and-why-is-it-important.html' title='What Is Science, And Why Is It An Important Part Of My Outlook On Life?'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-7140500398565533655</id><published>2009-02-19T09:37:00.001-05:00</published><updated>2009-02-19T09:40:19.144-05:00</updated><title type='text'>TOPICS FOR HIGHSCHOOL SCIENCE  (about 1570 terms)</title><content type='html'>BIOLOGY                              ~660wds&lt;br /&gt;&lt;br /&gt;ECOLOGY&lt;br /&gt;ecosystems, organisms, environment biotic abiotic, food chain/ web&lt;br /&gt;autotroph, primary producers, heterotrophs, primary consumers&lt;br /&gt;herbivore, secondary consumers, tertiary consumer, predator, prey&lt;br /&gt;carnivore insectivore omnivore, decomposers saprophytes&lt;br /&gt;symbiosis, parasite, host, pathogen, vector&lt;br /&gt;antibiotic, vaccine, malaria protoctist plasmodium anopheles mosquito&lt;br /&gt;&lt;br /&gt;small egg gambit,large egg gambit, perennial, annual&lt;br /&gt;herbaceous plants, woody plants, trees, shrubs&lt;br /&gt;&lt;br /&gt;biomes&lt;br /&gt;ocean, phytoplankton, plankton, benthos, upwelling&lt;br /&gt;desert, temperate forest, tropical forest, grasslands&lt;br /&gt;&lt;br /&gt;community, habitat, population, niche&lt;br /&gt;&lt;br /&gt;agriculture, monocrops, erosin, deforestation, carbon fixation&lt;br /&gt;renewable resources, non-renewable resources, extinction, habitat destruction&lt;br /&gt;pesticides&lt;br /&gt;&lt;br /&gt;classification, taxonomy&lt;br /&gt;&lt;br /&gt;kingdom&lt;br /&gt;monera, prokaryotes, bacteria, 20 metabolisms maintain biogeochem cycles&lt;br /&gt;eukayotes, unicellular, multicellular&lt;br /&gt;protista, protoctista, 30 non related groups    30,000 spp&lt;br /&gt;amoeba, paramecium, euglena, algae, pond scum&lt;br /&gt;fungi mushrooms, molds, yeasts, lichen, saprophytes, spores&lt;br /&gt;microorganisms microbes&lt;br /&gt;&lt;br /&gt;plantae 280,000 spp?&lt;br /&gt;bryophytes, mosses, ferns,&lt;br /&gt;conifers, seeds&lt;br /&gt;angiosperms, flowers, fruit&lt;br /&gt;monocotyledons grasses, wheat, lilies&lt;br /&gt;dicotyledons&lt;br /&gt;&lt;br /&gt;animalia heterotrophs, nervous system, blastula&lt;br /&gt;&lt;br /&gt;30 phyla&lt;br /&gt;mollusca 100,000 spp, snails, clams, octopi&lt;br /&gt;annelids, segmented worms, earthworms&lt;br /&gt;&lt;br /&gt;arthropoda 1-10million?  crustacean, crabs, shrimps, arachnids, spiders&lt;br /&gt;insects, exoskeleton, metamorphosis egg, larva, pupa, adult&lt;br /&gt;flies, wasps, bees, ants, lepidoptera, beetles&lt;br /&gt;&lt;br /&gt;echinoderms, starfish, sea urchins&lt;br /&gt;&lt;br /&gt;chordata, ectotherms coldblooded, endotherms warm blooded&lt;br /&gt;&lt;br /&gt;5  classes? aves / birds  amphibia  reptilia?  pisces / fish&lt;br /&gt;&lt;br /&gt;mammalia 4,629spp  placental, marsupial&lt;br /&gt;&lt;br /&gt;26 orders: rodentia 2024spp  chiroptera 928spp  insectivora 429sp shrews&lt;br /&gt;carnivora 271spp  artiodactyla 220spp antelopes deer cattle&lt;br /&gt;&lt;br /&gt;primates 236 spp&lt;br /&gt;12 families&lt;br /&gt;cebidae new world monkeys&lt;br /&gt;cercopithecidae old world monkeys  hominidae apes&lt;br /&gt;genus and species  gorilla gorilla  pan troglodytes  homo sapiens&lt;br /&gt;&lt;br /&gt;hybrid&lt;br /&gt;dichotomous key&lt;br /&gt;&lt;br /&gt;EVOLUTION&lt;br /&gt;fossils, evolution, homologous structures, vestigial structures&lt;br /&gt;island biogeography, thry of ev by natural selection, charles darwin&lt;br /&gt;overpopulation, variation mutation,&lt;br /&gt;differential survival (survival of the fittest)&lt;br /&gt;inheritance, adaption, speciation, extinction, genetics&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;CELLS&lt;br /&gt;microscope, robert hooke 1665 cells, size of cells, num of cells&lt;br /&gt;&lt;br /&gt;nutrients, 100 basic small molecules,&lt;br /&gt;minerals Na, Ca, Mg, K, transition metals&lt;br /&gt;vitamins, fat soluble A, D, E?&lt;br /&gt;water soluble B1 thiamine, B2 riboflavin, B12, C, K&lt;br /&gt;coenzymes&lt;br /&gt;&lt;br /&gt;carbohydrates, glucose etc, polymer, macromolecule&lt;br /&gt;polysaccharides starch glycogen cellulose&lt;br /&gt;&lt;br /&gt;22 amino acids&lt;br /&gt;1000+ proteins enzymes structural proteins&lt;br /&gt;nucleic acids ATP RNA DNA&lt;br /&gt;&lt;br /&gt;lipids cell membranes  fats oils cholesterol&lt;br /&gt;&lt;br /&gt;diffusion brownian motion, molecule, concentration gradient, active transport&lt;br /&gt;osmosis, cell membrane, exchange of food waste&lt;br /&gt;&lt;br /&gt;protoplasm, cytoplasm, nucleus, nuclear membrane, chromatin, viruses&lt;br /&gt;AIDS/HIV, endoplasmic reticulum, ribosomes, golgi ap,&lt;br /&gt;&lt;br /&gt;chromosome, genome, gene, replication, nucleotide, genetic code, mRNA&lt;br /&gt;tRNA, ribosomes, proteins&lt;br /&gt;&lt;br /&gt;vacoule, chloroplast, mitochondria, cell wall&lt;br /&gt;&lt;br /&gt;LIFE&lt;br /&gt;energy flow, entropy, maintenance of pattern, incorporation of food, growth&lt;br /&gt;&lt;br /&gt;PHOTOSYNTHESIS&lt;br /&gt;chloroplasts, chlorophyll, oxygen, hydrogen, carbon fixation&lt;br /&gt;&lt;br /&gt;CELLULAR RESPIRATION&lt;br /&gt;sugars, glucose, anerobic respiration, fermentation, aerobic respiration&lt;br /&gt;&lt;br /&gt;NITROGEN FIXATION&lt;br /&gt;amino acids, proteins, nucleic acids, dinitrogen, nitrogen fixing bacteria&lt;br /&gt;nitrogen cycle, legumes&lt;br /&gt;&lt;br /&gt;GLOBAL BIOGEOCHEM CYCLES&lt;br /&gt;water cycle, vegetation protects soil, transpiration in plants&lt;br /&gt;carbon cycle, redox, carbonates&lt;br /&gt;oxygen, sulfates, carbonates&lt;br /&gt;nitrogen cycle, bacteria&lt;br /&gt;&lt;br /&gt;GROWTH&lt;br /&gt;s.a to vol ratio, protists, animals, growth, tissues&lt;br /&gt;&lt;br /&gt;REPRODUCTION&lt;br /&gt;asexual reproduction, mitosis, chromosomes, prophase, metaphase, anaphase&lt;br /&gt;telophase&lt;br /&gt;&lt;br /&gt;SEX&lt;br /&gt;sexual reproduction, diploid, haploid, chromosome #, heredity, genetics&lt;br /&gt;gene, dominant, recessive ,homozygous, heterozygous, sickle celled anemia&lt;br /&gt;genetic diseases, genetic engineering, genetically modified food&lt;br /&gt;genetic fingerprintng&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;fertilization, gamete production, gametes, sperm, egg ovum, crossing over,&lt;br /&gt;recombination, meiosis, extra stages, law of independant assortment,&lt;br /&gt;sex chromos (det), x chromo, y chromo&lt;br /&gt;&lt;br /&gt;mutations, cloning&lt;br /&gt;&lt;br /&gt;ORGANISMS&lt;br /&gt;animal, plant, organism, embryo, development, cell specialization,&lt;br /&gt;organ systems&lt;br /&gt;&lt;br /&gt;nervous system, circ sys, resp sys, dig sys, excr sys, endocr sys, imm sys&lt;br /&gt;repro sys, musc skell sys&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;RESPIRATORY SYS&lt;br /&gt;lungs, diaphragm, breathing, alveoli, gas exchange, bronchioles, trachea&lt;br /&gt;&lt;br /&gt;DIGESTV SYS&lt;br /&gt;degestion, mechanical digestion, esophagus, saliva, extracellular digestion&lt;br /&gt;enzymes, stomach, gastric acids, fats - lipase, carbohydrates -  amylase&lt;br /&gt;proteins - pepsin, roughage ,small intestines, villi&lt;br /&gt;pancreas pancreatic juice=enzymes, liver&lt;br /&gt;gall bladder bile from liver = neutralize acid and emulsify fat&lt;br /&gt;absorbtion&lt;br /&gt;large intestine (colon), rectum feces anus, ulcer, acid reflux&lt;br /&gt;&lt;br /&gt;EXCRETORY SYSTEM&lt;br /&gt;excretion, urinary system, kidney, urine, urea, urinary bladder&lt;br /&gt;&lt;br /&gt;CIRC SYSTEM&lt;br /&gt;transport, arteries, veins, capillaries,&lt;br /&gt;to lungs, liver, stomach/intestines, kidneys, other tissues&lt;br /&gt;pulmonary artery, pulmonary vein, lungs, carbon dioxide, oxygen,&lt;br /&gt;heart, atria, ventricals, valves, pulse rate, coronary arteries, plaque&lt;br /&gt;heart attack, cholesterol, exersize&lt;br /&gt;&lt;br /&gt;blood, plasma, blood clotting, red blood cels, hemoglobin, diffusion&lt;br /&gt;&lt;br /&gt;white blood cells, lymphocytes produce antibodies, antibodies, phagocytes&lt;br /&gt;immunity, blood groups, rhesus factor Rh, organ transplants&lt;br /&gt;&lt;br /&gt;MUSC SKELET SYS&lt;br /&gt;bones 206, calcium phosphate, marrow, cartilage, joints, ball and socket&lt;br /&gt;ligaments tie bones together, osteoporosis, vertibrae, teeth, tooth decay&lt;br /&gt;&lt;br /&gt;muscles  about 600, skeletal voluntary striated, smooth involuntary, cardiac&lt;br /&gt;tendon&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;SKIN&lt;br /&gt;protection sensory water temperature regulation fat storage&lt;br /&gt;vitamin D production, hair sebaceous gland erector muscle&lt;br /&gt;epidermis with dead cell layer, dermis fibrous proteins&lt;br /&gt;subcutaneous layer fats, sweat gland&lt;br /&gt;&lt;br /&gt;REPRODUCTIVE SYSTEM&lt;br /&gt;gonads, testes, prostate, semen, ovaries, estrogen, uterus womb,&lt;br /&gt;menstrual cycle, ovulation, menstruation, menopause&lt;br /&gt;&lt;br /&gt;conception, zygote, embryo, pregnancy, implantation, fetus, amniotic fluid&lt;br /&gt;placenta, umbilical cord, miscarriage&lt;br /&gt;&lt;br /&gt;identical nonidentical twins, in vitro fertilization, breech birth&lt;br /&gt;cesaerean birth/section,, puberty adolescence, testosterone, estrogen&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;NERVOUS SYSTEM&lt;br /&gt;neurons, nerve impulse, synapse,&lt;br /&gt;sensory visual auditory taste olfactory touch  others&lt;br /&gt;animal senses lateral line, palps, antennae, whiskers, electrical&lt;br /&gt;motor, connecting,&lt;br /&gt;&lt;br /&gt;eye, iris, pupil, lens, retina, rods cones, optic nerve, occipital region&lt;br /&gt;&lt;br /&gt;ear hearing balance, middle ear eardrum malleus incus stapes&lt;br /&gt;inner ear cochlea, semicircular canals&lt;br /&gt;&lt;br /&gt;stroke, voluntary fcts, cerbrum, cerebellum&lt;br /&gt;involuntary fcts, medula oblongata,&lt;br /&gt;inv muscles smooth and cardiac, diaphragm peristalsis&lt;br /&gt;hypothalamus, autonomic nervous system, pituitary gland&lt;br /&gt;homeostasis water and heat regulation&lt;br /&gt;&lt;br /&gt;spine cord, reflexes, paralysis, vertibrae&lt;br /&gt;&lt;br /&gt;HOMEOSTASIS&lt;br /&gt;information between systems   hormones, nervous system, endocrine glands&lt;br /&gt;&lt;br /&gt;negative feedback&lt;br /&gt;metabolic rate thyroid gland thyroxine&lt;br /&gt;thermoregulation metabolic rate, skin, breathing behavior shivering&lt;br /&gt;readyness for action adrenal gland adrenaline&lt;br /&gt;osmoregulation kedneys, behavior drinking hypothalamus, pituitary&lt;br /&gt;glucose level pancreas insulin glucagon liver glycogen&lt;br /&gt;liver glucose levels, deamination of aminos, makes bile, stores vit A, D&lt;br /&gt; makes cholesterol, breaks down red cells, modifies harmful substances&lt;br /&gt; for removal by kidneys&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;PLANTS&lt;br /&gt;chloroplasts, vacuole 2dim fluid creature with turgor skeleton, meristem&lt;br /&gt;apical tissue buds, bud&lt;br /&gt;&lt;br /&gt;cambium, phloem, xylem&lt;br /&gt;&lt;br /&gt;leaf, palisade layer, stomate, transpiration&lt;br /&gt;&lt;br /&gt;stem, underground corm bulb rhizome stolon tuber&lt;br /&gt;&lt;br /&gt;root, root hairs, absorbs water and minerals, active transport, osmosis&lt;br /&gt;&lt;br /&gt;vegetative reproduction, clone&lt;br /&gt;&lt;br /&gt;flowers, sepal petal, stamen anther pollen, pistil stigma ovary fruit&lt;br /&gt;ovule seed, seed dispersal, germination, pollination&lt;br /&gt;wind pollination, insect pollination, nectar, seeds&lt;br /&gt;&lt;br /&gt;TROPISMS&lt;br /&gt;stomates, heliotropism,, geotropism gravity, hydrotropism, touch tropism&lt;br /&gt;plants explore their environment&lt;br /&gt;&lt;br /&gt;homo sapiens, chimpanzee, gorilla, primates&lt;br /&gt;little brown bat&lt;br /&gt;beaver, field mouse, rat, grey squirrel, hamster, porcupine&lt;br /&gt;blue whale, porpoise&lt;br /&gt;asian elephant&lt;br /&gt;raccoon&lt;br /&gt;possum, kangaroo&lt;br /&gt;seals&lt;br /&gt;ferret, skunk, river otter, sea otter&lt;br /&gt;dog, wolf, red fox, coyote&lt;br /&gt;cat, lion, tiger&lt;br /&gt;rhino, horse, zebra,&lt;br /&gt;cow, buffalo, sheep, goat, deer, girrafe, hippopotomus&lt;br /&gt;brown bear&lt;br /&gt;&lt;br /&gt;american eagle, red tailed hawk, mallard, canada goose, seagull, barn owl&lt;br /&gt;penguins, pigeon, mourning dove, ruby throat hummingbird, chicken&lt;br /&gt;parrots, downy woodpecker, crow, robbin, weaver finch, bluejay,&lt;br /&gt;black capped chickadee, ostrich&lt;br /&gt;&lt;br /&gt;alligator, gekko gekko, green anole, chameleons&lt;br /&gt;garter snake, anaconda, boa constrictor&lt;br /&gt;snapping turtle, box turtle, sea turtles&lt;br /&gt;american toad, bullfrog, spring peeper, red eft&lt;br /&gt;&lt;br /&gt;sunfish, armored catfish, goldfish, guppy, rainbow trout, moray eel, sharks&lt;br /&gt;chiclids, salmon, sea horses&lt;br /&gt;&lt;br /&gt;sea squirts&lt;br /&gt;starfish&lt;br /&gt;&lt;br /&gt;lobsters, fiddler crabs, beach fleas, barnacles, ostracods, cyclops&lt;br /&gt;sow bugs, small millipedes, stout centipede,&lt;br /&gt;dog tick, red water mites, red soil mites, oribitid mites&lt;br /&gt;argiope garden spider, phidipus&lt;br /&gt;&lt;br /&gt;apis mellifera, halictus, vespula, fig wasp&lt;br /&gt;atta, pheidole, formica, camponotus herculeanus&lt;br /&gt;house fly, mosquitoes, monarch, fall army worm&lt;br /&gt;june bug, coccinelidae, black carabids, weevils&lt;br /&gt;periplaneta, field cricket, migratory locust, aphids, fleas, Ajax&lt;br /&gt;round colembolans&lt;br /&gt;&lt;br /&gt;jelly fish, corals&lt;br /&gt;nematodes&lt;br /&gt;earthworm&lt;br /&gt;&lt;br /&gt;octopi, moon snails, cone snails, scallops, mussels&lt;br /&gt;yellow garden slug, long fresh water snails,&lt;br /&gt;&lt;br /&gt;stentor, euglena, phacus, volvox, chlamydomonas, fucus, diatoms&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;GEOLOGY                                     180wds&lt;br /&gt;&lt;br /&gt;MINERALS&lt;br /&gt;minerals 2,500 kinds, crystalline structure ,rocks, compounds, elements&lt;br /&gt;oxygen, silicon, aluminum, iron, calcium, potassium, magnesium, sodium,&lt;br /&gt;carbon, sulfur&lt;br /&gt;cleavage, hardness, color, lustre, density, color, crystal structure&lt;br /&gt;&lt;br /&gt;feldspar, olivine, pyroxene, amphibole, mica, quartz&lt;br /&gt;oxides sulfides ores, halides salt, carbonates seashells limetone&lt;br /&gt;&lt;br /&gt;ROCKS&lt;br /&gt;volcanism, magma, igneous, intrusive, granite, pegmatites,&lt;br /&gt;extrusive, basalt, obsidian&lt;br /&gt;&lt;br /&gt;metamorphic, mountain building, contact metamorphism&lt;br /&gt;slate, gneiss, schist, marble, quartzite,&lt;br /&gt;&lt;br /&gt;weathering erosion, sedimentary, conglomerate, sandstone, shale, limestone&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;EROSION&lt;br /&gt;weathering, mechanical, freezing water, temperature change,biotic movement&lt;br /&gt;chemical, water, carbonic acid, clays, limestone caves, oxidation&lt;br /&gt;biotic production of soil&lt;br /&gt;&lt;br /&gt;erosion, mass wasting landslides, glaciers, u shaped valleys, glacial till&lt;br /&gt;wind, running water, rain, floods, rivers, deltas, grand canyon&lt;br /&gt;&lt;br /&gt;soil, regolith results of weathering, plants, burrowing, worms, ants, humus&lt;br /&gt;soil, climate, nitrates, phosphorus, potassium, calcium, magnesium,sulfates&lt;br /&gt;pedalfer northern forests humus sand clay iron aluminum&lt;br /&gt;pedocal midwest west grasslands calcite less rain&lt;br /&gt;laterites tropics less humus more iron aluminum less silica&lt;br /&gt;&lt;br /&gt;agriculture, soil waste, soil conservation&lt;br /&gt;&lt;br /&gt;TECTONICS MOUNTAIN BUILDING&lt;br /&gt;plaate tectonics, continental drift, pangea, crust,&lt;br /&gt;mantle, outer core, inner core&lt;br /&gt;magnetic field, north magnetic pole  (maps) (geography?)&lt;br /&gt;angle of declination changes many degrees per cent&lt;br /&gt;density, seismic waves, earthquakes, richter scale&lt;br /&gt;&lt;br /&gt;mantle convection, upper mantle, asthenosphere, lithosphere, plates,&lt;br /&gt;continental crust, ocean crust&lt;br /&gt;&lt;br /&gt;mid ocean ridges, divergent boundaries, sea floor spreading&lt;br /&gt;convergent boundaries, subduction zone, mountain building, volcanoes&lt;br /&gt;ocean trenches, island arcs, continental convergent boundaries&lt;br /&gt;himalayas appalachians&lt;br /&gt;transform fault, earthquakes&lt;br /&gt;&lt;br /&gt;GEOLOGICAL TIME&lt;br /&gt;stratigraphy, paleontology, geochronology, relative age ,radiometric dating&lt;br /&gt;radioactive decay, age of earliest rocks, fossils, mass extinctions&lt;br /&gt;&lt;br /&gt;precambrian, paleozoic era, trilobites&lt;br /&gt;permian extinction 70 90% spp lost&lt;br /&gt;mesozoic era triassic jurassic cretaceous, dinosaurs, ammonites&lt;br /&gt;mammals angiosperms insects birds, cretaceous extinction&lt;br /&gt;cenezoic era&lt;br /&gt;quaternary period past 2million years, pleistocene epoch, ice ages&lt;br /&gt;holocene recent since last ice age/agriculture&lt;br /&gt;archaeology&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;OCEANOGRAPHY                                        25wds&lt;br /&gt;sea level, changes in sea level, glaciation, tides, spring tide, neap tide,&lt;br /&gt;ocean, ice, ground water, rivers and lakes, water vapor, estuaries,&lt;br /&gt;ocean currents, surface currents, convection currents, coriolis effect&lt;br /&gt;gulf stream, north atlantic gyre, deep currents,&lt;br /&gt;salinity, temperature, density&lt;br /&gt;&lt;br /&gt;continental shelf, avg depth&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;ATMOSPHERE                              143wds&lt;br /&gt;weather, meteorology, temperature, humidity, pressure, cloudiness, wind&lt;br /&gt;precipitation&lt;br /&gt;&lt;br /&gt;climate, climatology, latitude, altitude, topography of landforms&lt;br /&gt;land and water distribution, ocean currents, prevailing winds&lt;br /&gt;belts of high low  atmospheric pressure, cloud cover, axis tilt,&lt;br /&gt;uneven insolation, uneven heating, solar constant, seasons, climates&lt;br /&gt;climate change, ice ages, global warming&lt;br /&gt;weather is the mechanism by which heat reradiated from the surface to&lt;br /&gt; the atmosphere is moved around from one place to another&lt;br /&gt;radiation, conduction, convection ,advection (wind), coriolis effect&lt;br /&gt;circular cells, high pressure anticyclone clockwise in n. hem&lt;br /&gt;low pressure cyclone, equator calmer coriolios effect&lt;br /&gt;tropics overhead sun more heat in than out&lt;br /&gt;north and south poles more heat out than in&lt;br /&gt;ice caps, belts of high low pressure, prevailing winds, land&lt;br /&gt;sea breeze land breeze ?? which dir?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;ATMOSPHERIC COMPOSITION&lt;br /&gt;troposphere, cloud formation, tropopause, ozone layer, ultraviolet radiation&lt;br /&gt;chlorofluorohydrocarbons cfcs, stratosphere, ionosphere, exosphere&lt;br /&gt;&lt;br /&gt;nitrogen, oxygen, water vapour, argon helium neon and nitrogen, carbon dioxide&lt;br /&gt;&lt;br /&gt;WATER CYCLE&lt;br /&gt;evaporation, convection, humidity, relative humidity, saturation, condensation&lt;br /&gt;dew, frost, fog, clouds, condensation nuclei, precipitation&lt;br /&gt;&lt;br /&gt;FRESHWATER BODIES&lt;br /&gt;ponds, lakes, rivers, swamps, estuaries&lt;br /&gt;&lt;br /&gt;anomolous expansion of water&lt;br /&gt;&lt;br /&gt;CLOUDS&lt;br /&gt;stability /altitude, unstable low, cumulus clouds, cumulonimbus / thunderhead&lt;br /&gt;stable, cirrus  high wispy  cirrocumulus mackeral sky&lt;br /&gt;stratus clouds low, nimbostratus  low rain bearing&lt;br /&gt;rain, drizzle, sleet, snow&lt;br /&gt;&lt;br /&gt;air masses, source regions, stability&lt;br /&gt;tropical polar air masses diverge from source&lt;br /&gt;middle latitues exhibit convergence called fronts&lt;br /&gt;cold front, warm front, stationary front&lt;br /&gt;occluded front warm air mass entirely lifted over cold&lt;br /&gt;coriolis effect, cyclone counterclockwise in north hem., low pressure&lt;br /&gt;cumulonimbus thunderstorm, hail, turbulence, friction, static charges&lt;br /&gt;lightning, current 10,000 amps, temperature 30,000 deg, lightning rod&lt;br /&gt;conduction, thunder,&lt;br /&gt;hurricanes, tornadoes, wind speed&lt;br /&gt;&lt;br /&gt;weather forcasting, National Oceanic and Atmospheric Administration&lt;br /&gt;weather stations, weather satellites, radar&lt;br /&gt;temperature - thermometer - deg cels fahr&lt;br /&gt;humidity - psychrometer - %hum&lt;br /&gt;pressure - mercurial barometer aneroid barometer - millibars inches mercury&lt;br /&gt;precipitation  - rain gauge - centimeters/inches rainfall&lt;br /&gt;wind - anemometer - compass direction, miles per hour&lt;br /&gt;weather map&lt;br /&gt;long range forcasting 6,7 days&lt;br /&gt;longer not poss because the atmosphere is a chaotic system&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;CHEMISTRY                                   330wds&lt;br /&gt;matter, solid, liquid, gas, plasma&lt;br /&gt;&lt;br /&gt;elements, atoms, mixture, chemical symbol, compounds, molecules&lt;br /&gt;chemical formula, structural formula,&lt;br /&gt;reactivity, electrical conductivity, heat conductivity, luster,&lt;br /&gt;metal, alkali and alkaline earths gr 1, 2, nonmetal, metalloids&lt;br /&gt;density, boiling point, solubility&lt;br /&gt;&lt;br /&gt;hydrogen helium&lt;br /&gt;carbon nitrogen oxygen phosphorus sulfer chlorine&lt;br /&gt;iron silicon aluminum&lt;br /&gt;gallium germanium arsenic tin antimony&lt;br /&gt;nickel copper zinc silver gold lead mercury&lt;br /&gt;vanadium chromium manganese cobolt molybdenum, Zinc&lt;br /&gt;sodium magnesium potassium calcium&lt;br /&gt;noble gases He, Ne etc&lt;br /&gt;rare earth elements&lt;br /&gt;&lt;br /&gt;gasses, law of definite proportions, Lavoisier and the discovery of oxygen&lt;br /&gt;Mendeleyev, periodic law, periodic chart of elements, group, period&lt;br /&gt;atomic number, electron shells, valence, electron, atomic weight, isotopes&lt;br /&gt;&lt;br /&gt;CHEMICAL REACTIONS&lt;br /&gt;chemical change, physical change, reactants, products&lt;br /&gt;forward reaction, backward reaction, irrersible reaction, reversible reaction&lt;br /&gt;equilibrium, chemical equation, coefficients, subscripts,&lt;br /&gt;conservation of matter, balancing equations,&lt;br /&gt;synthesis, decomposition, combustion, redox, neutralization, precipitate&lt;br /&gt;&lt;br /&gt;MIXTURES, COMPOUNDS&lt;br /&gt;mixtures, solution, solute, solvent, polar solvent, water, alcohol&lt;br /&gt;non-polar solvent, detergents&lt;br /&gt;&lt;br /&gt;homogeneous, aqueous solution, distillation,&lt;br /&gt;solid solution, alloy, distinct proportions, brass, bronz, steel&lt;br /&gt;amalgam mercury&lt;br /&gt;&lt;br /&gt;BONDING&lt;br /&gt;electrons, ionic bond, electromagnetic attraction, valence shell&lt;br /&gt;covalent bond, octet rule, metalic bond, hydrogen bonding,&lt;br /&gt;van der Waal's forces&lt;br /&gt;&lt;br /&gt;small covalent molecules diatomic triatomic, covalent networks&lt;br /&gt;ionic compounds, cations metals, anions nonmetals, metals&lt;br /&gt;&lt;br /&gt;CHEMICAL CALCULATIONS&lt;br /&gt;atomic mass unit, gram, atomic mass, molecular mass, mole, molar mass&lt;br /&gt;molar volume of a gas, (calcs on pg 155 science dict)&lt;br /&gt;&lt;br /&gt;concentration, liter, mliter, density, volume, molar solution, titration&lt;br /&gt;&lt;br /&gt;chemical energy, electricity, heat, light, potential energy,&lt;br /&gt;exothermic reaction, combustion, heat of reaction?&lt;br /&gt;jouls, kjouls, calories, Calories&lt;br /&gt;&lt;br /&gt;temperature, specific heat capacity, heat energy, thermal energy&lt;br /&gt;change of state&lt;br /&gt;&lt;br /&gt;thermometer, fahrenheit, celsius, freezing point, boiling point&lt;br /&gt;kelvin or absolute scale, absolute zero, gas laws&lt;br /&gt;&lt;br /&gt;KINETIC THEORY pg 178-181&lt;br /&gt;fluid is gas or liquid, melting melting point freezin point&lt;br /&gt;boiling point, evaporation, vapor pressure, condesnsation, sublimation&lt;br /&gt;brownian motion, diffusion, kinetic theory of gases&lt;br /&gt;boyle law: pv=k, charles : v=kt, pv=nRt,&lt;br /&gt;absolute zero, kelvin scale&lt;br /&gt;STP 0celsius and 1 atm 22.4liters /mole&lt;br /&gt;&lt;br /&gt;pascal= newton per sqare meter 101,325/atm/760mm Hg&lt;br /&gt;mercury barometer&lt;br /&gt;&lt;br /&gt;THE ELEMENTS&lt;br /&gt;hydrogen gas helium gas&lt;br /&gt;coal, graphite, diamond, bucky balls&lt;br /&gt;carbon dioxide, carbon monoxide, carbonic acid, carbonate,  methane ...&lt;br /&gt;carbohydrates, organic molecules, hydrocarbons, ethane, propane&lt;br /&gt;petroleum, lipids,&lt;br /&gt;ammonia, amino acids,&lt;br /&gt;oxygen gas, water, ozone, phosphate phosphoric acid, sulfate sulfuric acid&lt;br /&gt; nitrate nitric acid, metal ores&lt;br /&gt;chlorine gas, chlorinated hydrocarbons, CFCs&lt;br /&gt;ATP, nucleic acids,&lt;br /&gt;hydrogen sulfide, metal ores, protein cross bonding&lt;br /&gt;iron oxides rust, magnetite etc steel,&lt;br /&gt;silicon (electronics), along with the other semiconductors Ga, Ge, As, Sb, Sn&lt;br /&gt; silicon dioxide (quartz) glass, (Fe, Na, Mg, K, Ca)aluminosilicate minerals&lt;br /&gt;aluminum, aluminum oxide (rubies, abrasive)&lt;br /&gt;bronze Cu+Sn, arsenic, brass Cu+Zn&lt;br /&gt;transition metal ions for enzymes, magnesium in chloroplast, etc&lt;br /&gt;table salt, metal ions in biol solution, calcium carbonate, calcium sulfate&lt;br /&gt; calcium phosphate,&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;ACIDS BASES SALTS&lt;br /&gt;ion, hydrogen ion, bydroxide ion, acid&lt;br /&gt;organic acids: acetic acid citric ascid&lt;br /&gt;mineral acids: hydrochloric acid, sulfuric, nitric, carbonic&lt;br /&gt;base, alkaline, ammonia borax lye detergents,&lt;br /&gt;neutralization reaction, salt, electrolytes, neutral, litmus test,&lt;br /&gt;pH, logarithmic scale, concentration, solubility&lt;br /&gt;&lt;br /&gt;oxidation, reduction, oxidizing gent, reducing agent&lt;br /&gt;&lt;br /&gt;rusting&lt;br /&gt;corrosion when metals and minerals come in contact with acids&lt;br /&gt;electroplating&lt;br /&gt;sulfer dioxide, carbon dioxide, nitrogen dioxide pollution-&gt;acids&lt;br /&gt;acid rain&lt;br /&gt;&lt;br /&gt;electric cell, battery, rechargeable battery&lt;br /&gt;dry cell alkline cell car battery&lt;br /&gt;voltage, direct current&lt;br /&gt;&lt;br /&gt;pH balance, buffers, balance in blood&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;reaction rate, affected by temp, increased by catalysts, catalysts&lt;br /&gt;chemical equilibrium, static equilibrium, dynamic equilibrium&lt;br /&gt;what is a steady concentration of moites due to balancing cyclic reactions&lt;br /&gt; of a system not in thermodynamic equilibrium?&lt;br /&gt;non equilibrium cycles ie atmos gases under sunlight&lt;br /&gt;enzymes&lt;br /&gt;&lt;br /&gt;EVERYDAY CHEM&lt;br /&gt;Haber process to fix N2 into ammonia for fertilizers etc&lt;br /&gt;petroleum, gasoline, natural gas, heating oil, coal&lt;br /&gt;&lt;br /&gt;ores, electrolytic reduction of aluminum ore bauxite&lt;br /&gt;smelting of iron ores&lt;br /&gt;&lt;br /&gt;sodium hydrogen carbonate bicarb of soda NaHCO3 baking soda?&lt;br /&gt;sodium carbonate Na2CO3 baking soda&lt;br /&gt;calcium oxide lime treat acid soils refine iron&lt;br /&gt;calcium hydroxide slaked lime&lt;br /&gt;&lt;br /&gt;chlorination of water to kill bacts&lt;br /&gt;hard water calcium and magnesium ions bind soap into scum, lv deposits&lt;br /&gt;&lt;br /&gt;charcoal&lt;br /&gt;NO and NO2 are emitted from car exhaust and facts: pollute&lt;br /&gt;&lt;br /&gt;alcohols, fermentation: sugar to alcohol and carbon dioxide&lt;br /&gt;organic acids, esters acid and alcohol to make fragrances and flavoring&lt;br /&gt;&lt;br /&gt;polymers, synthetic, nylon, rubber, polyester, acrylic&lt;br /&gt;flammability, warning labels, plastics&lt;br /&gt;&lt;br /&gt;chlorine bleach&lt;br /&gt;&lt;br /&gt;biodegradable, non-biodegradable&lt;br /&gt;air pollution, greenhouse gases, carbon dioxide, methane, CFSs,&lt;br /&gt;catalytic converter&lt;br /&gt;&lt;br /&gt;ATOMS&lt;br /&gt;atomic theory, dalton, avogadro, brownian motion, crystal structure&lt;br /&gt;x-ray diffraction, avogadro's number, mole, molar mass, atomic weights&lt;br /&gt;mass spectrometer, atomic mass, isotopes, nucleus, subatomic particles&lt;br /&gt;protons, neutrons, fusion, mass defect, mass energy eq E=Mc2&lt;br /&gt;electrons, charge, orbit, nuclear force, potential energy&lt;br /&gt;radioactivity&lt;br /&gt;radiation emwaves, xrays gamma rays and alpha beta particles&lt;br /&gt;background radioation&lt;br /&gt;radon gas&lt;br /&gt;alpha particle helium nuc pos chg doesnt pentrate far but highly ionizing&lt;br /&gt;beta particle electrons more penetrating but less ionizing&lt;br /&gt;gamma rad most penetrating but least ionizing, dict says most dangerous&lt;br /&gt;uranium, plutonium, thorium, carbon 14, radioactive decay, half life&lt;br /&gt;geiger counter, dosimeter, radioactive tracers in research&lt;br /&gt;radioisotope dating&lt;br /&gt;x-rays in research and medicine, CAT scans, MRI&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;nuclear fission chain reaction, nuclear reactor&lt;br /&gt;radioactive effect on living organisms, nuclear medicine&lt;br /&gt;radioactive waste disposal&lt;br /&gt;fission bomb (A-bomb), fusion bomb (H-bomb), fallout&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;PHYSICS                             ~200wds&lt;br /&gt;mechanics, gravity&lt;br /&gt;law of universal gravitation f=Gmm/r2&lt;br /&gt;law of inirtia body in motion or at rest remains (constant veloc) until acted&lt;br /&gt; on by a force resisted by inirtia= mass&lt;br /&gt;law of applied force change in vel and dir = acceleration in proportion to&lt;br /&gt; mass times force f=ma&lt;br /&gt;weight, magnitude, direction, vector, f=mg, mass kg, newtons&lt;br /&gt;law of action and opposite reaction&lt;br /&gt;(fuzzy on diff betwe action reaction pairs and equilibrium pairs)&lt;br /&gt;compression, tension&lt;br /&gt;equilibrium, stable unstable equilib&lt;br /&gt;spring force elastic potential energy hookes law f=kd&lt;br /&gt;friction force, tension&lt;br /&gt;momentum&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;CALCS&lt;br /&gt;significant figures, accuracy, precision, rounding&lt;br /&gt;length meter, mass kilogram, time second, temp kelvin, charge coulomb&lt;br /&gt;energy joule, force newton, pressure pascal, power watt&lt;br /&gt;conversions, scientific notation, ruler, caliper, balance, spring balance&lt;br /&gt;microscope, magnification, electron microscope, resolving power&lt;br /&gt;v=u+at, s=ut+.5at2, v2-u2=2as, f=ma&lt;br /&gt;&lt;br /&gt;periodic motion of spring, oscillation, circular motion&lt;br /&gt;centripetal force=product of mass and squre vel div by radius&lt;br /&gt;satellite orbits, escape velocity&lt;br /&gt;&lt;br /&gt;WORK&lt;br /&gt;work=force times distance in line of force&lt;br /&gt;newtons meter=joule, energy&lt;br /&gt;kinetic energy is one half product of mass and sqare of the veloc&lt;br /&gt;potential energy, grav pot energy = mgh&lt;br /&gt;power&lt;br /&gt;&lt;br /&gt;law of conservation of energy, electrical energy, chemical energy&lt;br /&gt;friction, heat, nuclear energy, light&lt;br /&gt;transducers: battery, light bulb, loudspeaker, solar cell, microphone, motor&lt;br /&gt;machines, lever, pulley, gear,&lt;br /&gt;&lt;br /&gt;pressure, hydraulic lift, bouyant force, archimedes principle&lt;br /&gt;&lt;br /&gt;STATES OF MATTER&lt;br /&gt;temperature, solid, liquid, gas, specific heat, heat of state change&lt;br /&gt;&lt;br /&gt;coefficient of expansion,&lt;br /&gt;gas law pv=nRT, fahrenheit, celsius, joul, cal&lt;br /&gt;mechanical energy to heat equivalent&lt;br /&gt;conduction, convection, radiation&lt;br /&gt;&lt;br /&gt;KINETIC THEORY OF MATTER&lt;br /&gt;temp = avg kinetic energy of molecules in gas&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;WAVES=periodic disturbance against a force(=work) through a vacuum or a&lt;br /&gt; medium which transmits energy.&lt;br /&gt;sound, light, vibratio, water waves, longitudinal waves: sound&lt;br /&gt;transverse waves: water waves, waves on a string, light&lt;br /&gt;crest, wavelength, frequency&lt;br /&gt;speed is product of wavelength times frequency&lt;br /&gt;doppler effect, speed of sound, ultrasound, sonar, pitch, loudness&lt;br /&gt;beats, harmonics, resonance&lt;br /&gt;&lt;br /&gt;opaque, translucent, transparent&lt;br /&gt;reflection, refraction, diffraction, interference, polarization&lt;br /&gt;refraction, lenses, magnification, telescope, microscope&lt;br /&gt;&lt;br /&gt;prism, spectrum&lt;br /&gt;subtractive mixing  things look green cause they absorb all other colors&lt;br /&gt;&lt;br /&gt;ELECTROMAGNETIC SPECTRUM&lt;br /&gt;gamma xray ultraviolet visible IR microwaves radio&lt;br /&gt;red orange yellow green blue indigo violet&lt;br /&gt;speed of light, inverse square law&lt;br /&gt;&lt;br /&gt;radio transmitter, radio waves, receiver&lt;br /&gt;transducer sound/light to electricity and back&lt;br /&gt;digital signal, analog signal, communication satellits&lt;br /&gt;&lt;br /&gt;photoelectric effect, electrons, energy is proportional to wavelength&lt;br /&gt;intensity, quantization of energy, photons, wave particle duality&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;ELECTRICITY&lt;br /&gt;magnetism, lodestone, compass, Earth'spoles, magnetic field&lt;br /&gt;likes repell unlikes attract&lt;br /&gt;&lt;br /&gt;STATIC ELECTRICITY&lt;br /&gt;frictional static buildup, charge&lt;br /&gt;law of electrostatics like charges repell, unlikes attract&lt;br /&gt; force is product of the charges div by sqare of dist&lt;br /&gt;coulomb, insulator, conductor&lt;br /&gt;magnetic force due to electric dipole moments of atoms aligned in solid&lt;br /&gt;electroscope, lightning&lt;br /&gt;&lt;br /&gt;ELECTRIC CURRENT&lt;br /&gt;current is charge per second, amps, electromagnet, electric buzzer very clever&lt;br /&gt;&lt;br /&gt;electric potential volt, capacitor, direct current, amps, circuit, battery&lt;br /&gt;ammeter, voltmeter, resistance ohms, resistor, superconductor&lt;br /&gt;faradays law of induction of emf, generator, alternator, alternating current&lt;br /&gt;transformer, elec eneryg joul kwatt hour, power watts, fuse, electromagnet&lt;br /&gt;loudspeaker&lt;br /&gt;&lt;br /&gt;atomic energy coal solar energy wind hydroelectric tidal geothermal&lt;br /&gt;&lt;br /&gt;electronics, transister, light emitting diode, silicon integrated cuircuits&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;SCIENTISTS                             29wds&lt;br /&gt;250 bce Aristarchos of Samos  how to find dist to moon by earths shadow&lt;br /&gt;      and tried to get distance to sun, at least showed it was bigger than&lt;br /&gt;      earth and guessed that earth revolved around it!&lt;br /&gt;240 bce Eratosthenes diameter of Earth&lt;br /&gt;200 bce Archimedes&lt;br /&gt;150 bce Hipparchus of Nicaea calculated distance to moon&lt;br /&gt;1600 Galileo Galilei&lt;br /&gt;1615 William Harvey&lt;br /&gt;1662 Robert Boyle&lt;br /&gt;1665 Robert Hooke&lt;br /&gt;1665 Isaac Newton&lt;br /&gt;1750 Carl Linnaeus&lt;br /&gt;1765 James Watt&lt;br /&gt;1796 Edward Jenner&lt;br /&gt;1800 Alessandro Volta&lt;br /&gt;1803 John Dalton&lt;br /&gt;1808 Humphrey Davy&lt;br /&gt;1811 Amadeo Avogadro&lt;br /&gt;1831 Michael Faraday&lt;br /&gt;1827 Robert Brown&lt;br /&gt;1850 Jean Louis Rodolph Agassiz&lt;br /&gt;1859 Charles Darwin&lt;br /&gt;1869 Dimitri Mendeleev&lt;br /&gt;1875 Louis Pasteur&lt;br /&gt;1876 AlexanderGraham Bell&lt;br /&gt;1879 Thomas Alva Edison&lt;br /&gt;1894 Pierre Curie  curie pt.&lt;br /&gt;1895 Gugliemo Marconi&lt;br /&gt;1897 Joseph Thomson&lt;br /&gt;1898 Mare Curie&lt;br /&gt;1905 Albert Einstein&lt;br /&gt;1919 Ernest Rutherford&lt;br /&gt;1928 Alexander Fleming&lt;br /&gt;1955 Isaac Asimov suggests C14 decay in DNA can cause mutations&lt;br /&gt;1961 Francis Crick&lt;br /&gt;1961 James Watson&lt;br /&gt;1961 Rosalind Franklin&lt;br /&gt;1979 Walter Alvarez end cretaceous iridium band&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-7140500398565533655?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/7140500398565533655/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=7140500398565533655' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7140500398565533655'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7140500398565533655'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/02/topics-for-highschool-science-about.html' title='TOPICS FOR HIGHSCHOOL SCIENCE  (about 1570 terms)'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-5371448626610912046</id><published>2009-02-18T17:55:00.002-05:00</published><updated>2009-04-13T14:45:41.765-05:00</updated><title type='text'>males and females but no sex! weird ants:</title><content type='html'>Wasmannia auropunctata, the little fire ant. native to the new world tropics but a very invasive pest worldwide does sex REALLY WEIRD:&lt;br /&gt;&lt;br /&gt;Fournier, D., A. Estoup, R. M. Orivel, J. Foucaud, H. Jourdan, J. Le Breton, and L. Keller. 2005. Clonal reproduction by males and females in the little fire ant. Nature 435:1230-1234:&lt;br /&gt;&lt;br /&gt;"discovered that W. auropunctata has remarkable and peculiar reproductive biology. Their abstract is as follows:&lt;br /&gt;&lt;br /&gt;Sexual reproduction can lead to major conflicts between sexes and within genomes. Here we report an extreme case ...&lt;br /&gt;&lt;br /&gt;We found that sterile workers are produced by normal sexual reproduction, whereas daughter queens are invariably clonally produced.&lt;br /&gt;[i don't know if this means clones of queen's diploid somatic cell, or produced from an unfertilized haploid egg, which is produced by meiosis and therefore not a strict clone of the queen mother, will have to investigate]&lt;br /&gt;&lt;br /&gt;some pics here, more explanation to come soon in new entry:&lt;br /&gt;&lt;br /&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://4.bp.blogspot.com/_uPFMFfHgGGg/SeIxM3bsztI/AAAAAAAAAHE/xUeGOiQEkCk/s1600-h/auropunctata+central+fusion.JPG"&gt;&lt;img style="cursor: pointer; width: 400px; height: 291px;" src="http://4.bp.blogspot.com/_uPFMFfHgGGg/SeIxM3bsztI/AAAAAAAAAHE/xUeGOiQEkCk/s400/auropunctata+central+fusion.JPG" alt="" id="BLOGGER_PHOTO_ID_5323871806613671634" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;either way the offspring are &lt;span style="font-style: italic;"&gt;effectively&lt;/span&gt; clones&lt;br /&gt;&lt;br /&gt;&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://1.bp.blogspot.com/_uPFMFfHgGGg/SeIxccx_svI/AAAAAAAAAHM/Qu-PHVkYTy8/s1600-h/auropunctata+results+of+many+generations+of+automixis+with+crossover.JPG"&gt;&lt;img style="cursor: pointer; width: 400px; height: 291px;" src="http://1.bp.blogspot.com/_uPFMFfHgGGg/SeIxccx_svI/AAAAAAAAAHM/Qu-PHVkYTy8/s400/auropunctata+results+of+many+generations+of+automixis+with+crossover.JPG" alt="" id="BLOGGER_PHOTO_ID_5323872074337334002" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;...&lt;br /&gt;&lt;br /&gt;In an apparent response to this conflict between sexes, genetic analyses reveal that males reproduce clonally, most likely by eliminating the maternal half of the genome in diploid eggs. [!!!] As a result, all sons have nuclear genomes identical to those of their father.&lt;br /&gt;&lt;br /&gt;The obligate clonal production of males and queens from individuals of the same sex effectively results in a complete separation of the male and female gene pools...."&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;In summary: queens give rise to fertile queens by cloning.  males mate with queens and give rise to&lt;br /&gt;&lt;br /&gt;1) sterile diploid workers&lt;br /&gt;&lt;br /&gt;2) males with only the males genes which effectively means they are clones of the males. wait! in most ants males are haploid and all their sperm are clones of their somatic cells. i'm gonna have to find more info. are auropunctata males haploid or dipoid?&lt;br /&gt;&lt;br /&gt;roughly then males clone males of themselves and females clone females of themselves. the only time 'sex' (fertilization) results in offspring, those offspring are sterile..&lt;br /&gt;&lt;br /&gt;weird.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;from:&lt;br /&gt;&lt;a target="_top" href="http://academic.evergreen.edu/projects/ants/genera/wasmannia/species/auropunctata/auropunctata.html"&gt;http://academic.evergreen.edu/projects/ants/genera/wasmannia/species/auropunctata/auropunctata.html&lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-5371448626610912046?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/5371448626610912046/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=5371448626610912046' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5371448626610912046'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5371448626610912046'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/02/males-and-females-but-no-sex-weird-ants.html' title='males and females but no sex! weird ants:'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://4.bp.blogspot.com/_uPFMFfHgGGg/SeIxM3bsztI/AAAAAAAAAHE/xUeGOiQEkCk/s72-c/auropunctata+central+fusion.JPG' height='72' width='72'/><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-7024985411081607438</id><published>2009-02-18T09:47:00.001-05:00</published><updated>2009-02-18T09:48:40.494-05:00</updated><title type='text'>Braided History of Human Psychology, Biology, Society (old outline from college)</title><content type='html'>I wish to attempt to short circuit and reexamine some ancient strands of our culture/primate heritage: language, vision and consciousness.  Our vision creates smoothly bounded objects and our language names and separates them out of experience.  Our consciousness isolates them in time and stills their movement.&lt;br /&gt;&lt;br /&gt;Primates: the tribe that thirsted for miracles.&lt;br /&gt;&lt;br /&gt;The creatures that primates began to get involved with: flowers, fruits, colors, all intertwined in the forest canopy called us out into great creativity.&lt;br /&gt;&lt;br /&gt;Let us now focus on the local dances around some of these bizarre solutions; the primates.  I will look at three simultaneous developments that occurred.  Developments in their ecology, attention structures, and mental life.&lt;br /&gt;&lt;br /&gt;What happened with primates then is that their range of ecological interactions began to diversify, reaching a peak of flexibility in the lives of our hunter-gatherer ancestors right before agriculture sprung up.  These bands commonly played their ecosystems very nimbly and flexibly, picking amongst hundreds of plant and animal species for food and craft depending on the seasons and availability.  This must have given these early cultures a very intimate and complex ecological sensitivity. Perhaps see early meso-american art.&lt;br /&gt;&lt;br /&gt;Then curiously they pulled in their ecological tendrils and agricultural patterns began to spread like wildfire to the point where except for the very affluent among us, most agricultural populations interacted predominantly with less than a dozen species.  At least as far as food was concerned.&lt;br /&gt;&lt;br /&gt;This system is unstable.&lt;br /&gt;&lt;br /&gt;It repeatedly collapses and spreads.&lt;br /&gt;&lt;br /&gt;Agricultural life also developed strange living patterns in which geometrically, our cultures began to become isolated from complex raging ecosystems.  Especially the intellectuals in the cities and desert monasteries.  The intimate and complex ecological sensitivity began to disappear.&lt;br /&gt;&lt;br /&gt;While all this was happening, the development of primate attention structures went in and out of phase with their ecology. Attention was continually contracting.  Up to five prehensile limbs, three dimensional dynamic environment, nocturnal existence primarily communicating by sound and touch, and smell.&lt;br /&gt;&lt;br /&gt;Then loose the prehensile tail,&lt;br /&gt;&lt;br /&gt;become diurnal,&lt;br /&gt;&lt;br /&gt;communicate by vision, facial expression,&lt;br /&gt;&lt;br /&gt;a space before the eyes develops where the two front limbs can manipulate objects,&lt;br /&gt;&lt;br /&gt;then loose the prehensile feet, two dimensional environment, the space before the eyes worked on by the hands or occupied by another's face becomes predominant.&lt;br /&gt;&lt;br /&gt;This space becomes internalized.  The conscious, alone, individual develops.  The Ego.&lt;br /&gt;&lt;br /&gt;Neoteny.  Learning.  Culture.  Adults that play.&lt;br /&gt;&lt;br /&gt;Archetype librarians.&lt;br /&gt;&lt;br /&gt;Third strand.  Somewhere along the way we end up with a hell of a lot of brain.  Some consequences.&lt;br /&gt;&lt;br /&gt;This brain became the substrate in which these internalized spaces could develop.&lt;br /&gt;&lt;br /&gt;Evolution had another structure to work with which was sensitive to miracles: culture.&lt;br /&gt;&lt;br /&gt;Most incredible however, was that within each individual an entire evolving ecosystem of interacting ideas was  possible.&lt;br /&gt;&lt;br /&gt;And the time in which it takes to come up with solutions is minutes to years instead of millennia.&lt;br /&gt;&lt;br /&gt;We forget to respect the wisdom of the DNA librarians.&lt;br /&gt;&lt;br /&gt;These three strands intertwining within the relatively short time of a few million years.  Problems were bound to come up.&lt;br /&gt;&lt;br /&gt;One of the most dramatic problems was that of learning to cope with the shift in the level of who solves problems, who is sensitive to miracles from the ecosystem to the culture to the individual.  (see Hebrew scriptures)&lt;br /&gt;&lt;br /&gt;From cosmological time to cultural time to an individual's life time.  These shifts occurred so quickly that our species has made quite a mess out of piecing together the story of how ecosystems, cultures, states, economies, and minds really think, create, and pray.  Mythic resonance of time scales.&lt;br /&gt;&lt;br /&gt;Myth of isolated conscious willed self enclosed in a sack.&lt;br /&gt;&lt;br /&gt;Myth of causative agents.&lt;br /&gt;&lt;br /&gt;Lose understanding of complex threads and cycles of flow and causation in ecosystems. towards logic.&lt;br /&gt;&lt;br /&gt;When such a system becomes ill, when we have an emotion or experience we fix it on an object.  (the dev of emotion spaces in the body.  Jaynes)&lt;br /&gt;&lt;br /&gt;We imagine a monster Causes the illness.&lt;br /&gt;&lt;br /&gt;We instantiate that monster in something real.&lt;br /&gt;&lt;br /&gt;We kill it.&lt;br /&gt;&lt;br /&gt;When such a system is beset by an accident we mistakenly pin the horror of its fall on an evil causative agent rather than its fragility and the complexity of its sustenance.&lt;br /&gt;&lt;br /&gt;Idolatry.&lt;br /&gt;&lt;br /&gt;The trading city state as interface (dissipative structure)&lt;br /&gt;&lt;br /&gt;Mesopotamian civilization&lt;br /&gt;&lt;br /&gt;Spires with spreading tendrils reaching up towards God&lt;br /&gt;&lt;br /&gt;Sacrifice&lt;br /&gt;&lt;br /&gt;The king sacrifices his life for the city&lt;br /&gt;&lt;br /&gt;Gilgamesh.  Kings no longer willing to sacrifice themselves&lt;br /&gt;&lt;br /&gt;War between cities.  Tendrils recoil from each other.&lt;br /&gt;&lt;br /&gt;Empire.  The sack.  The carefully guarded boundaries.&lt;br /&gt;&lt;br /&gt;Empires collapse&lt;br /&gt;&lt;br /&gt;Myth of self&lt;br /&gt;&lt;br /&gt;Thera incident.&lt;br /&gt;&lt;br /&gt;Assyrians&lt;br /&gt;&lt;br /&gt;Jews, Greeks, Persians&lt;br /&gt;&lt;br /&gt;Myth of causative agents&lt;br /&gt;&lt;br /&gt;Evil&lt;br /&gt;&lt;br /&gt;Mistaken ideas about sin.&lt;br /&gt;&lt;br /&gt;Jaynesian consciousness&lt;br /&gt;&lt;br /&gt;Distancing from Earth&lt;br /&gt;&lt;br /&gt;Loss of respect for stuff&lt;br /&gt;&lt;br /&gt;ignorance of Earth's ways&lt;br /&gt;&lt;br /&gt;Christian amalgam&lt;br /&gt;&lt;br /&gt;Dark ages&lt;br /&gt;&lt;br /&gt;Protestants&lt;br /&gt;&lt;br /&gt;Science&lt;br /&gt;&lt;br /&gt;Technology&lt;br /&gt;&lt;br /&gt;Industry&lt;br /&gt;&lt;br /&gt;Post WWII Western malaise&lt;br /&gt;&lt;br /&gt;Forgetting the Archetype Librarians&lt;br /&gt;&lt;br /&gt;Annihilation?&lt;br /&gt;&lt;br /&gt;Hope:&lt;br /&gt;&lt;br /&gt;God as challenge&lt;br /&gt;&lt;br /&gt;Jesus&lt;br /&gt;&lt;br /&gt;Newton allowed for the miraculous in his thought&lt;br /&gt;&lt;br /&gt;Darwin&lt;br /&gt;&lt;br /&gt;Thermodynamics&lt;br /&gt;&lt;br /&gt;Poincare&lt;br /&gt;&lt;br /&gt;Jung&lt;br /&gt;&lt;br /&gt;Cybernetics&lt;br /&gt;&lt;br /&gt;Dynamical systems theory&lt;br /&gt;&lt;br /&gt;Bateson&lt;br /&gt;&lt;br /&gt;Prigogene&lt;br /&gt;&lt;br /&gt;Systems theory in family therapy.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-7024985411081607438?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/7024985411081607438/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=7024985411081607438' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7024985411081607438'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7024985411081607438'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/02/braided-history-of-human-psychology.html' title='Braided History of Human Psychology, Biology, Society (old outline from college)'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-3888607474742276460</id><published>2009-02-15T19:25:00.002-05:00</published><updated>2009-02-15T19:30:51.967-05:00</updated><title type='text'>How To Find What The Earth Is Made Of Inside</title><content type='html'>The simplest facts would be the size and mass of the earth, from these we can calculate the  average density of the earth and try to guess what it might be made out of to give that density.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;CHAPTER 1.  Size of Earth.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Eratosthenes of Cyrene (276 BC - 194 BC) was the first to figure out the size of the Earth.  His results have been confirmed by numerous other techniques beginning with Columbus finding out that there was a whole other continent sitting in  the Atlantic and Pacific oceans between him and China.&lt;br /&gt;&lt;br /&gt;here is an explanation with diagrams of how he did it:&lt;br /&gt;&lt;br /&gt;http://www.eg.bucknell.edu/physics/astronomy/astr101/specials/eratosthenes.html&lt;br /&gt;&lt;a href="http://www-groups.dcs.st-and.ac.uk/%7Ehistory/Biographies/Eratosthenes.html"&gt;&lt;br /&gt;more info on Eratosthenes:&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;note:&lt;br /&gt;his result is: 250,000 stadia.  From various records we think his stadia are somewhere around 160m each+/-20m.  Let's say 160m.    250,000 stadia  X ~160m  = 4,000,000 meters in circumference/3.14= 1,300,000 meters, so the radius is 6.5X10^6meters.  We'll use that value, it's not bad.&lt;br /&gt;&lt;br /&gt;(this also comes out to: ..  X 1mile/1600meters =25,000 miles in circumference or 8000 miles in diameter.)&lt;br /&gt;&lt;br /&gt;so now we can find its volume=(4/3)pi*r^3&lt;br /&gt;=4*(6.5X10^6)^3&lt;br /&gt;=4X275X10^18 cubic meters&lt;br /&gt;1100X10^18&lt;br /&gt;10^21 cubic meters&lt;br /&gt;&lt;br /&gt;that's big!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;CHAPTER 2.  Mass of the Earth (Or How Much Does the Earth 'Weigh'?)&lt;br /&gt;&lt;br /&gt;Well, by watching things fall and observing planets make ellipses around the sun, Isaac Newton summarized that the gravitational force between two bodies is equal to G*M*m/d^2,   where M,m are masses of the bodies, d is their distance and G is some constant that he didn't know very accurately.  The point of his formula is that even without knowing the constant, the formula gives the right SHAPES for the orbits of the planets.  It even gives all three of Keplers laws:&lt;br /&gt;&lt;br /&gt;[link to summary of Kepler's laws?]&lt;br /&gt;&lt;br /&gt;He also worked out that this force is also = the mass of either  of the bodies times its acceleration.&lt;br /&gt;&lt;br /&gt;so GMm/d^2 = ma&lt;br /&gt;&lt;br /&gt;notice that  m cancels out!  the mass of the falling body doesn't affect the acceleration of its fall, something Galileo first showed.&lt;br /&gt;&lt;br /&gt;GM/d^2=a&lt;br /&gt;&lt;br /&gt;so if we drop a rock here near the  Earth's surface,   we can measure the acceleration: a; it's 9.8m/s^2, so&lt;br /&gt;&lt;br /&gt;GM/d^2 =9.8m/s^2&lt;br /&gt;&lt;br /&gt;d=distance from our rock near the surface of the earth to center of mass of the Earth=the radius of the Earth&lt;br /&gt;so&lt;br /&gt;&lt;br /&gt;G*M/(6.5X10^6)^2 =9.8m/s^2&lt;br /&gt;&lt;br /&gt;look: we've got our equation down to only two variables!  If we can measure G, we can figure out M the mass of the earth.  Weighing the earth!  Not bad!  How can we figure out G?&lt;br /&gt;&lt;br /&gt;Let's go back to f=GMm/d^2.  If we can somehow measure the force between two known masses, say bowling balls, and measure their distance, we could do it! The problem is that we hardly find any force at all when we try this, gravity is actually a pretty weak force, it only SEEMS so strong to us,  because the earth is SO MASSIVE.&lt;br /&gt;&lt;br /&gt;But  Henry Cavendish managed to measure this small force in 1783!  Very clever man.  he hung something like a dumbbell from a quartz fiber with a mirror attached to it.  He then shined a beam of light at the mirror and watched its reflection move across the opposite wall.  This setup amplified the subtle twisting motions of the apparatus.  He then put two weights near the dumbbell to attract it, and observed the oscillations as the apparatus settled down.    By measuring the oscillations he could determine the gravitational force between the masses that twisted the fiber.&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.fourmilab.ch/gravitation/foobar/"&gt;here's a long description of how careful you have to be in setting one up in your basement:&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www.physics.sfsu.edu/%7Eggrist/490/Cavrpt/cavrpt.html"&gt;Here is a description of the calculation of G from the angle of deflection of the dumbbell:&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;INTERLUDE OF CONFUSION TO BE CLEARED UP&lt;br /&gt;( I am still unclear at exactly what parameters of the oscillation is being measured, and the final formula giving the torque on the fiber.   torque=-k*theta&lt;br /&gt;and&lt;br /&gt;torque =f*moment arm=GMmL/r^2&lt;br /&gt;&lt;br /&gt;to his&lt;br /&gt;&lt;br /&gt;G=r^2*pi^2*L*theta/MT^2&lt;br /&gt;&lt;br /&gt;where T is the period of the oscillator.&lt;br /&gt;&lt;br /&gt;But what theta is he measuring?  As the device settles, doesn't theta get smaller?&lt;br /&gt;&lt;br /&gt;i think i need to use the harmonic oscillator equation:&lt;br /&gt;a=-omega^2*Asin(sqrt(k/m)t)) and some working out.  I’ll have to do that later.)&lt;br /&gt;END INTERLUDE&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;so G turns out to be a ridiculously small number:&lt;br /&gt;&lt;br /&gt;~6 x 10^-11 N m2/kg2&lt;br /&gt;&lt;br /&gt;we are ready to weigh the earth!&lt;br /&gt;&lt;br /&gt;G*M/(6.5X10^6)^2 =9.8m/s^2&lt;br /&gt;M=gr^2/G ok&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;M= 9.8m/s^2 X 42 X 10^12m^2 /( 6X10^-11 Nm^2/kg^2)&lt;br /&gt;9.8m/s^2  X  42X10^12 m^2 / (6X10^-11 kgm^3/kg^2s^2)&lt;br /&gt;9.8m/s^2 X  42 X 10^12 m^2 / (6X10^-11 m^3/kg/s^2)&lt;br /&gt;=  10X42/6 X 10^12 /10^-11 m^3 kg s^2 / (s^2Xm^3)&lt;br /&gt;=70X10^23kg  (WHEW! the units work, no mistakes)&lt;br /&gt;7X10^24kg!&lt;br /&gt;&lt;br /&gt;The currently accepted value is  5.9742 × 10^24 kilograms  not bad using these simple experiments!&lt;br /&gt;&lt;br /&gt;now we are ready to calculate the density of the Earth:&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;CHAPTER 3.  Calculating the Density of The Earth and Guessing at What it is Made of.&lt;br /&gt;&lt;br /&gt;d=mass/volume&lt;br /&gt;&lt;br /&gt;ok&lt;br /&gt;d=7X10^24kg/10^21 m^3&lt;br /&gt;=7X10^3kg /m^3.&lt;br /&gt;&lt;br /&gt;lets convert that to grams/cc&lt;br /&gt;&lt;br /&gt;7X10^3kg/m^3X1000g/kgXm^3/10^6cm&lt;br /&gt;=7g/cc!  now we know something about the Earth!  That is a very reasonable number for density, We are on the right track!&lt;br /&gt;&lt;br /&gt;water has density 1g/cc, and here is the clincher:  most rocks we find at the surface of the earth and even down a few miles by drilling, have a density of between 2 and 3g/cc&lt;br /&gt;&lt;br /&gt;so the earth is full of something even more dense than these minerals at depths deeper than we can drill.  that is our FIRST clue as to what's inside.&lt;br /&gt;&lt;br /&gt;to bring the overall density of the earth to 7g/cc the minerals below 2 miles or so have to have average density MORE than 7g/cc.&lt;br /&gt;&lt;br /&gt;what minerals are like that?  we can guess iron because it's the most common dense element in crustal rocks, all others are very rare in comparison.&lt;br /&gt;&lt;br /&gt;density of iron is:  7.8g/cc  hmm.. maybe there are denser metals down there?  or is it almost all iron?  or does the density increase under pressure?&lt;br /&gt;&lt;br /&gt;we could use some geometry to figure out how large a proportion of the earth's center needs to be iron to bring the average density up to 7 from the 2.5 of the density at the crust.&lt;br /&gt;&lt;br /&gt;The next chapters could be:  (4)  We can find more clues by listening to the whole Earth ring like a bell when it receives a shock from an earthquake or nuclear explosion.  We can even listen more carefully to three DIFFERENT types of sound waves that travel through the Earth after earthquakes.   (5) We can do experiments on various minerals to see how they behave under different pressures. (6)  We can explore the electromagnetic properties of the Earth which seem to be telling us something about processes in the core.  (7) There is also the convenient fact that corals and algae have been patiently recording the length of the day, and the length of the lunar month over the past 2 billion years!  I think this data can be used to get some ideas of the density profile vs. depth of the earth using principles of moment of inertia.&lt;br /&gt;&lt;br /&gt;In sum, it is pretty amazing that from some observations of shadows in a few different cities, plotting the courses of the planets in the night sky, fitting them to a mathematical formula, measuring the acceleration of falling bodies, measuring the twist of a fiber given by balls attracted to each other, and measuring the density of minerals, we can get some guesses at what kinds of minerals there are 4000 miles down in the center of the Earth.&lt;br /&gt;&lt;br /&gt;On the other hand the amount of work put in by Copernicus, Tycho Brahe, Kepler, Galileo, and Newton was immense.  And the experiment of Cavendish, genius and delicate.  This is the story of science.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-3888607474742276460?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/3888607474742276460/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=3888607474742276460' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3888607474742276460'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3888607474742276460'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/02/how-to-find-what-earth-is-made-of.html' title='How To Find What The Earth Is Made Of Inside'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-5874825001498188800</id><published>2009-01-10T10:54:00.002-05:00</published><updated>2009-01-10T10:57:48.120-05:00</updated><title type='text'>Becoming human: we woke up to rich mental lives and found no mechanisms for them!</title><content type='html'>First of all, our SENSORY world alone is extraordinary.  1000s of shades of color, textures, detailed environment we find ourselves in. we see millions of details around us.  in one visual scene we can move our eyes focus our attention on ... i don't know what's the number of pixels?  could one count the number of details in one visual scene?  the number of leaves on all the trees?  the number of edges, intersections, the number of culices in each cloud, the nmber of cracks in the sidewalk...&lt;br /&gt;&lt;br /&gt;details of clouds, sunsets, bugs, birds, rocks, pebbles, shades of staining on a sidewalk...&lt;br /&gt;&lt;br /&gt;there is music around us the howling of the wind, the light tinkle of leaves or ice against each other, the wealth of birds robin, crow, bluejay, english sparrow, cardinal, chickadee, mourning dove, catbird, mockingbird, chipping sparrow, song sparrow, white throated sparrow, downy woodpecker, tufted titmouse, seagull, red tailed hawk, starling, redwinged blackbird, wood thrush, scarlet tanager, bohemian waxwing,...  and already there are musicians among them&lt;br /&gt;&lt;br /&gt;and the crickets and grasshoppers and katydids, the nye nye nye bugs...&lt;br /&gt;&lt;br /&gt;and the tones, we start making them ourselvese and we discover octaves, and 5ths and we sing songs ourselves and usually play them on what seem to be scales of from 5 to a dozen notes per octave, and rhythms...&lt;br /&gt;&lt;br /&gt;and the smells of hyacinths, roses, fresh cut grass, cow patties, wormwood, dry grass, honeysuckle sea breaze and the tastes...  tomato, strawberry, potato, carrot, turkey, oregano, cheese, cinnamon, mango, chocolate, blueberries, grapes, broccoli, oranges, greapfruits, apples, pears, cherries, almonds, peanuts, shrimp, eggyolk, salt, pepper, milk, caramel... 100s of plants and spices to eat.&lt;br /&gt;&lt;br /&gt;and the stars at night, we can make patterns in 100s of stars and the patterns of the paths of the 7 planets and their resonances.  we can count.  the day repeats, teh seasons repeat the position of the sun repeats, the position of venus jupiter repeat, we count the resonances, complex, they drive us to count more and more detailed ratios.&lt;br /&gt;&lt;br /&gt;and touch and athletics and sex&lt;br /&gt;&lt;br /&gt;and the wealth of activities that human life explodes into: weaving, sailing, woodcarving, smelting, exploring, hunting, tracking, farming, digging, climbing, running, swimming, wrestling, throwing, bow hunting, racing, games of chance, board games, dancing, playing flutes, strings, drums, rhythms, sweating, kissing, eating, shitting, massaging, combing hair, birthing, being sick, vomiting, dying, crying, laughing, clinging, rubbing, breathing, orgasms both female and male, and nursing,&lt;br /&gt;&lt;br /&gt;and the wealth of stories humans get into from these activities, growing up, pain, falling in love, jealosy, breaking up, making choices, journeys, learning, discovering, choosing, dilemmas, contests, hating, organizing, building, villages, families, feudes, disputes, arbitrating, sleuthing, policing, fighting, war, nations, organizing farmland, organizing roads, organizing irrigationworks, organizing postal systems, organizing men,&lt;br /&gt;&lt;br /&gt;states of mind of fear, wonder, pleasure, puzzlement, confusion, ecstacy, awe, concentration,&lt;br /&gt;&lt;br /&gt;and all the while, we experience, act  while swimming in a swirling sea of strong emotions, desires, lusts, exuberances, fears..  our emotional lives, both private and communal can seem like forces that can twist steel, explode mountains, bring down cosmic floods upon mankind&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;this is an incredibly rich sensory world we woke up to.  did it happen relatively suddenly?  don't know.&lt;br /&gt;&lt;br /&gt;and the amazing part of the story is that we could MATCH our sensory world. in detail, in intensity.&lt;br /&gt;&lt;br /&gt;we could draw, paint, sculpt, weave.&lt;br /&gt;&lt;br /&gt;but our greatest match in intensity was language/music.&lt;br /&gt;&lt;br /&gt;we easily excelled all birds in melody and rhythm.  and we gave a good shot at matching them in tonal texture with our bewildering variety of musical instruments.  and in ecstatic states we could easily out sing dance drum any bird for longer than it could stay awake.&lt;br /&gt;&lt;br /&gt;and the complexity of language, we were able to match thing for thing with words.  given any thing in that complex visual environment we could match it.  acute angle which nevertheless doesn't come to a point between the two spikes in that dark leathery green oak leaf with the embossed surface 4" long and thinner than a fingernail, supple but not drooping...&lt;br /&gt;&lt;br /&gt;if anyone attempted to catalogue language, write a dictionary, we found that there were 1000s of words of dozens of parts of speach with complex particular rules of combination and we could combine them in an effectively countably infinite number of ways.&lt;br /&gt;&lt;br /&gt;and with this language with which we could describe every visual thing...&lt;br /&gt;&lt;br /&gt;and we attempted to describe feelings with language too, which was very hard.  and to do it we invented song and poetry.  human poetry is our attempt to map out feeling states...&lt;br /&gt;&lt;br /&gt;and the stories...  we wove long stories of individual's  lives, of conflicts with familily, friends and enemies,  longer stories of the lives of states and history and ultimately tackled the life of the cosmos itself.  these narratives were longer than any birdsong, any whalesong if we were even listening then...&lt;br /&gt;&lt;br /&gt;we could give a name for every different sounding bird, looking insect, tasting plant, and we could make order out of it, cataloguing these organisms finding order making patterns...&lt;br /&gt;&lt;br /&gt;we mapped the stars, and named patterns in them.  we timed the days and planets and found patterns in them deeper and deeper and we could predict them.&lt;br /&gt;&lt;br /&gt;we classified legal disputes, kin relationships, and told stories.&lt;br /&gt;&lt;br /&gt;eventually with our powers of imagination some of us were able to outsing any bird, out mathematize any planetary ratio, out count any number of real things, imagine more and more complicated stories between complicated lives...&lt;br /&gt;&lt;br /&gt;a human storyteller could CREATE characters more compelling then real people.  we DID bring dumb clay golems to life.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;at some point in the ancient literate world our powers of imagination outstripped the sensory world we were paying attention to (not that we were capable of ever imagining that there WAS more to sense, 8 THOUSAND differnt birds?  16 MILLION square miles of earth to explore?  SIX HUNDRED THOUSAND species of beetles?)  but at some point our creativity outstripped our DESIRE to explore the sensory realm, and then the trouble began.&lt;br /&gt;&lt;br /&gt;this happened because literate societies moved out of rich jungles onto desert flood plains and people moved into cities.&lt;br /&gt;&lt;br /&gt;deserts, floodplains, cities are depaupered sensory worlds.  and the density of population, the speciliztion in crafts over took the sensory world and all the complexity moved into human interactions and imagination under the dark night sky.&lt;br /&gt;&lt;br /&gt;and there lay the trouble.&lt;br /&gt;&lt;br /&gt;and once we begun to band in cities powered by floodplain agriculture, all hell broke loose.  we began to amass wealth, we began to organize men, the minds and intentions and wills of men in 1000s in 100s of thousands.  and we were able to transform landscapes within the time of historical memory of a place.  we organized the flooding of the nile and the euphrates.  we checkered the landscape for miles in irrigationworks and fields.  we organized the lives of dozens of species of plants and animals to our wills.  we built walls that went for 1000s of miles, we build small mountains in egypt, we built our own jungles of urban landscapes, we built large ships to travel oceans, we waged wars of 10s of thousands of organized fighters against each other.&lt;br /&gt;&lt;br /&gt;human mind became powerful in the world.&lt;br /&gt;&lt;br /&gt;we denuded hilsides in our quest for agriculture and earth finally rebelled.  the floods began.&lt;br /&gt;&lt;br /&gt;but they didn't stop us.&lt;br /&gt;&lt;br /&gt;and now that the human mind was able to build walls and pyramids, organize irrigation works, cities and wars.. we begun to ask "where does this powerful complex deep mind come from?"&lt;br /&gt;&lt;br /&gt;it made more songs than all the birds, it wasn't there.  it made more words than all the insects, it wasn't there.  it told more stories than the nuances of cooked fruit and vegatables, it wasn't there.  look inside the split flesh of a freshly killed hero in battle  where is the vitality?  where is the keeness of his mind?  where is the complexity to weave the stories he told at night?&lt;br /&gt;&lt;br /&gt;we did not see it.&lt;br /&gt;&lt;br /&gt;and so we invented spirits gods and demons.  but they weren't really explanations.&lt;br /&gt;&lt;br /&gt;in fact we were lost.  we failed to discover, to understand who we were.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;that discovery had to wait till the rise and fall of several more empires, civilizations, till a curious combination of semitic sacred storytelling about a one pointed power in the universe a one pointed historical sense joined up with a curious greek sense of universalism and logic spread across a rambunctious european puzzlework of nations.&lt;br /&gt;&lt;br /&gt;and science was born out of the christian european trade economy.  and once again we began to explore our sensory world.  and it exploded.  the decimal points (from india) of exact calculations of the movements of planets, the hacking out of algebraic laws of motion, the cataloguing of 2000 different minerals into 56 cryastal structures, 96 elements...  the 1000s of man hours of grueling cooking experiments it took to fathom the chemistry of the elements, and then we found more than 1000s of differernt organic molecules.&lt;br /&gt;&lt;br /&gt;then the sea explorations 1000s of plants and animals, 10s of thousands by lineas' time, 100s of thousands, 2million current count, but when one team of scientists REALLY tried looking they found hundreds of species of beetles just on one of a 100,000 different species of tropical trees.  just HOW many can there be?&lt;br /&gt;&lt;br /&gt;and the geological strata..&lt;br /&gt;&lt;br /&gt;and pushing chemistry to the limits with microscopes and radiolabeling and cleverness and 1000s of 1000s of hours of experiments till we come to learn the confederation of a 100billion cities with all their moving parts that can make up the vitality and mind of a human.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;but the story is barely evident.  for the first chapter of this story has 30,000 years of records to back it up.  and we've only been on the 2nd chapter of scientific journey for a mere 400 years, and only a small portion of humanity has been traveling it.  It has hardly been told...&lt;br /&gt;&lt;br /&gt;in in the meanwhile human life has exploded into another dense urban network, this time the whole globe in seatravel, air travel, world wide commerce and finally instantaneous electronic communication and the density of humans 6billion of us and we are realizeing that we are warping our whole world's climate and ecosystems...&lt;br /&gt;&lt;br /&gt;the pace of change has outstripped the traditional generation time of human storytelling...&lt;br /&gt;&lt;br /&gt;back in ancient times our brains became conscious of their own intellectual powers.  but now this new global brain of instant world wide communication and invention has yet to come to consciousness.&lt;br /&gt;&lt;br /&gt;we are lost again.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-5874825001498188800?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/5874825001498188800/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=5874825001498188800' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5874825001498188800'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5874825001498188800'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2009/01/becoming-human-we-woke-up-to-rich.html' title='Becoming human: we woke up to rich mental lives and found no mechanisms for them!'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-7066258667284073406</id><published>2008-11-26T14:51:00.003-05:00</published><updated>2010-11-30T10:17:11.365-05:00</updated><title type='text'>The Windweaving Of The Minds Of Crows</title><content type='html'>a walk one afternoon&lt;br /&gt;of blustery snowy weather,&lt;br /&gt;i found a dark quiet corner&lt;br /&gt;on a country street&lt;br /&gt;at Mercer and Ryckman&lt;br /&gt;of tall spindly spruces.&lt;br /&gt;a nook amongst houses.&lt;br /&gt;&lt;br /&gt;clumped on snowy boughs,&lt;br /&gt;a congregation of crows&lt;br /&gt;facing this way and that&lt;br /&gt;dozens of crows sat cackling&lt;br /&gt;&lt;br /&gt;snowfulls of wind&lt;br /&gt;burst down on us&lt;br /&gt;moving tall trees to sway&lt;br /&gt;proved strong wood to be woven&lt;br /&gt;like supple cloth&lt;br /&gt;&lt;br /&gt;crows leapt into wind&lt;br /&gt;wove their way high&lt;br /&gt;into complex wind curls&lt;br /&gt;then,&lt;br /&gt;suddenly,&lt;br /&gt;pulling wings in&lt;br /&gt;batmobiles&lt;br /&gt;to plummet like rocks&lt;br /&gt;perilously&lt;br /&gt;&lt;br /&gt;miraculously, i thought&lt;br /&gt;peeling out&lt;br /&gt;again&lt;br /&gt;twist against whirlwind&lt;br /&gt;feathers splayed&lt;br /&gt;&lt;br /&gt;to land just so&lt;br /&gt;almost sighing&lt;br /&gt;a feathery touch&lt;br /&gt;beside their fellows&lt;br /&gt;on a branch of snow&lt;br /&gt;&lt;br /&gt;how?&lt;br /&gt;&lt;br /&gt;amazingly skilled!&lt;br /&gt;sky full of acrobats&lt;br /&gt;and not a wing snapped&lt;br /&gt;not a crow plummeted&lt;br /&gt;to earth&lt;br /&gt;&lt;br /&gt;their wings weigh nothing!&lt;br /&gt;thin bird bones hold, how?&lt;br /&gt;feathers?&lt;br /&gt;interlocked feathers?&lt;br /&gt;stronger than bone?&lt;br /&gt;&lt;br /&gt;tense feathers like fingers?&lt;br /&gt;THAT much control?&lt;br /&gt;sense eddies of wind with&lt;br /&gt;hundreds of feather tips?&lt;br /&gt;&lt;br /&gt;what fine invention&lt;br /&gt;woven exoskeleton!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;and i yearned to know&lt;br /&gt;do they play for wind?&lt;br /&gt;do crows take pleasure&lt;br /&gt;in mastery of wind?&lt;br /&gt;or only mildly inconvenienced&lt;br /&gt;to use pedestrian craft against wind&lt;br /&gt;while merely adjusting&lt;br /&gt;social arrangements on boughs?&lt;br /&gt;&lt;br /&gt;even so,&lt;br /&gt;when as crow kids&lt;br /&gt;to learn such fine skills&lt;br /&gt;they must have played these games&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;and i yearned to know&lt;br /&gt;ignorant of crow speech&lt;br /&gt;become a scientist?&lt;br /&gt;spend grueling winter months&lt;br /&gt;to huddle in bird blinds&lt;br /&gt;fingers numb watching&lt;br /&gt;clever experiment&lt;br /&gt;after subtle experiment&lt;br /&gt;to trick them to spill&lt;br /&gt;their secrets?&lt;br /&gt;&lt;br /&gt;winding crow flight&lt;br /&gt;inspires me to thought weaving&lt;br /&gt;how do brains grow?&lt;br /&gt;more flexible weaving there!&lt;br /&gt;never hardwired straight from the genes.&lt;br /&gt;no, nerves play,&lt;br /&gt;weave through each other&lt;br /&gt;while crow kids play,&lt;br /&gt;weave through windgames&lt;br /&gt;mind and brain&lt;br /&gt;weave each other&lt;br /&gt;&lt;br /&gt;into dense but flexible nets&lt;br /&gt;of thought and skill&lt;br /&gt;&lt;br /&gt;worlds became woven&lt;br /&gt;that fine wintry day&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-7066258667284073406?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/7066258667284073406/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=7066258667284073406' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7066258667284073406'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7066258667284073406'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/11/windweaving-of-minds-of-crows.html' title='The Windweaving Of The Minds Of Crows'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-3990262984283809747</id><published>2008-09-01T21:39:00.005-05:00</published><updated>2009-04-17T16:53:43.339-05:00</updated><title type='text'>Thunderstorms Of Sperm Swim The Well Of Life</title><content type='html'>&lt;br&gt;&lt;br /&gt;from the well of her mouth&lt;br /&gt;to the burning bush which conceals a deeper well...&lt;br /&gt;well of wombs.&lt;br /&gt;&lt;br /&gt;to connect eye to eye like hovering eagle and dove&lt;br /&gt;to connect tongue to tongue like entwining serpents&lt;br /&gt;to delight nipple to nipple like the leaping gazelle&lt;br /&gt;to fit my arm around her waist as climbing a tree&lt;br /&gt;and hover rock back and forth like the waves over the beach birthing life&lt;br /&gt;and sink the tree of life into the hot wet depths, the black smokers&lt;br /&gt;rocking rocking with the moon&lt;br /&gt;climbing climbing with the intensity of the building storm clouds&lt;br /&gt;to burst like crack of thunder bursting rain into earth&lt;br /&gt;and wait the   passage  of seasons&lt;br /&gt;till spring springs forth a sprig of us&lt;br /&gt;new child.&lt;br /&gt;&lt;br /&gt;to wander in the desert of loneliness&lt;br /&gt;to wander the moist summer nights in the alleys of cities hungry&lt;br /&gt;to see a flash of flouncing dark curls&lt;br /&gt;eyes to eyes flicker with recognition&lt;br /&gt;forgotten depths in them&lt;br /&gt;to find a long lost sister&lt;br /&gt;sit in the car in the parking lot for hours telling our stories.&lt;br /&gt;listening&lt;br /&gt;the eyes the mouths hovering closer and closer together&lt;br /&gt;wanting to kiss&lt;br /&gt;wanting to kiss all&lt;br /&gt;like the mouths of babies exploring a fresh world&lt;br /&gt;&lt;br /&gt;spring meadow on a sunlit day&lt;br /&gt;brewing to humid storm slowly&lt;br /&gt;the dark clouds build&lt;br /&gt;the static electricity in the air builds&lt;br /&gt;to spark tongue to nipple lightning&lt;br /&gt;amid the flashes to run for cover in the bushes&lt;br /&gt;&lt;br /&gt;electricity of earth runs through us&lt;br /&gt;the ancient sea tides of mating birth and death run through us&lt;br /&gt;three billion generations of life giving to life&lt;br /&gt;life dancing skillfully holding to balance&lt;br /&gt;in the flow of sunlight to the cold dark void&lt;br /&gt;in the face of the grim reaper of entropy&lt;br /&gt;life passing on the flame of redox cycle from torch to torch&lt;br /&gt;in a marathon 3.6billion years in the running breathing panting&lt;br /&gt;still winning&lt;br /&gt;&lt;br /&gt;and the tides of life the little ones&lt;br /&gt;the seeking pseudopods of protoplasm reaching out from me&lt;br /&gt;pods of me splitting from me on their own journey&lt;br /&gt;seeking past me&lt;br /&gt;past my time&lt;br /&gt;wait by the sea for their journey&lt;br /&gt;&lt;br /&gt;and the storm builds&lt;br /&gt;the sea parts&lt;br /&gt;the danger is imminent&lt;br /&gt;and they pour out lives of me to live or die&lt;br /&gt;and swim the storm current to another world&lt;br /&gt;lives of me&lt;br /&gt;tiny seed boats of my ancestors&lt;br /&gt;packed with ancient tails of fibers woven nine by two&lt;br /&gt;swim up the sea another world&lt;br /&gt;&lt;br /&gt;she tastes different&lt;br /&gt;it's a swim uphill the salmon take to spawn&lt;br /&gt;to die&lt;br /&gt;they race each other&lt;br /&gt;help each other&lt;br /&gt;like Beowulf and Brecca egging each other on in heroic exploits&lt;br /&gt;her eggself is waiting with the torch of life to carry on&lt;br /&gt;but she needs incitement&lt;br /&gt;needs marriage to the community else she too will be expelled&lt;br /&gt;the stillborn floating down the bloody nile&lt;br /&gt;&lt;br /&gt;they arrive&lt;br /&gt;come to rest on her yolky breast&lt;br /&gt;release the hold on life beating protoplasm&lt;br /&gt;just sing her my half of the song&lt;br /&gt;and set her to splitting&lt;br /&gt;&lt;br /&gt;songserpents of me entangling in her libraries&lt;br /&gt;weaving another story in this life epic&lt;br /&gt;&lt;br /&gt;&lt;br&gt;&lt;br /&gt;&lt;br&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-3990262984283809747?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/3990262984283809747/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=3990262984283809747' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3990262984283809747'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3990262984283809747'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/09/thunderstorms-of-sperm-swim.html' title='Thunderstorms Of Sperm Swim The Well Of Life'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-9003048613370013727</id><published>2008-08-28T16:01:00.003-05:00</published><updated>2009-03-28T09:53:21.722-05:00</updated><title type='text'>How to Explore Whether the Universe Is a Loving God (Cosmological Anthropic Principle)</title><content type='html'>&lt;span class="fbod quote"&gt;Wolfram, in his book "a new kind of science" (poorly written, full of himself, but FASCINATING DATA) shows how scores of different kinds of the complex cellular automata (&lt;a href="http://blackskimmer.blogspot.com/2007/07/john-horton-conways-game-of-life-here.html"&gt;one example here&lt;/a&gt;) can simulate each other, and in a sense, ANY cellular automata (or mathematical system, or machine) which is reasonably complex enough can do ANYTHING that we consider interesting. This leads me to the following kinds of questions:&lt;br /&gt;&lt;br /&gt;is the kind of biological life we have (and brains and behavior and minds and experiences) a consequence of the particular kind of chemistry this universe gives us, or would ANY remotely interesting chemistry be able to produce critters like us? Wolfram's results HINT at a yes for the latter possibility.&lt;br /&gt;&lt;br /&gt;This is interesting because we can extend it to the following dilemma:&lt;br /&gt;&lt;br /&gt;There is a concept called the cosmological anthropic principle. (look it up) In it SOME physicists say that if the physical constants to the universe as we understand them now, where just .00000001% different, suns would not form, atoms would not be created in them, and no chemistry even would result, let alone life. These people and some christians too, use this argument to say that the universe was fine tuned to create us, and that means either a god who loves us created it, or the universe itself is some kind of god who loves us.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Their argument is faulty however! Yes, we can tell that if the universe where .0000001% different our kind of chemistry and suns and planets and life wouldn't exist, BUT we are NO WHERE near capable as physicists and mathematicians to predict what ELSE might happen.  (We had quantum chemistry for 60 years or so and never even figured out Bucky Balls from scratch!)  Things on space and time scales that we couldn't imagine might become interesting &lt;span style="font-style: italic;"&gt;instead&lt;/span&gt;, and this might be interesting enough in the sense of Wolfram's results, to create systems that could create TOTALLY different critters, who can nevertheless become richly interesting, come to explore and 'know' the universe and be  'worthy of a god's love'.&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;span class="fbod quote"&gt;So where does that leave us?&lt;br /&gt;&lt;br /&gt;If in a 1000 more years of math and science we COULD show that this universe is the only kind that can produce interesting beings, well, that would be interesting. can't imagine how we could do that, but there are some mathematical results that might point the way.&lt;br /&gt;&lt;br /&gt;the other result? say we can map out ALL possible physicses.. (ok, maybe 10,000 years from now...) and show that 99% of them end up with something interesting (this is like exploring the phase space of the parameters of a dynamical system...) THAT would be interesting too.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-9003048613370013727?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/9003048613370013727/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=9003048613370013727' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/9003048613370013727'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/9003048613370013727'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/08/how-to-explore-whether-universe-is.html' title='How to Explore Whether the Universe Is a Loving God (Cosmological Anthropic Principle)'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-4913237604015790646</id><published>2008-08-12T17:41:00.005-05:00</published><updated>2008-08-12T18:02:47.501-05:00</updated><title type='text'>Loricifera, Cycliophora, Micrognathia: New Phyla  Get Me Wondering About Twisty Metazoan Evolution</title><content type='html'>&lt;a href="http://icb.oxfordjournals.org/content/vol42/issue3/images/large/i1540-7063-042-03-0641-f01.jpeg"&gt;pic of loriciferan and life cycle&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://icb.oxfordjournals.org/content/vol42/issue3/images/large/i1540-7063-042-03-0641-f02.jpeg"&gt;pic of cycliophora and life cycle&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://icb.oxfordjournals.org/content/vol42/issue3/images/large/i1540-7063-042-03-0641-f03.jpeg"&gt;pic of micrognathia and phylogeny&lt;/a&gt;&lt;br /&gt;&lt;span style="text-decoration: underline;"&gt;&lt;span style="font-weight: bold;"&gt;&lt;/span&gt;&lt;/span&gt;&lt;a href="http://icb.oxfordjournals.org/cgi/content/full/42/3/641#I15407063042030641F01"&gt;&lt;strong&gt;&lt;nobr&gt;&lt;/nobr&gt;&lt;/strong&gt;&lt;/a&gt;&lt;br /&gt;&lt;div id="titleLine"&gt;from:&lt;br /&gt;&lt;br /&gt;&lt;a href="http://icb.oxfordjournals.org/cgi/content/full/42/3/641#I15407063042030641F01"&gt;"An Introduction to Loricifera, Cycliophora, and Micrognathozoa" by Reinhardt Møbjerg Kristensen&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;/div&gt;     &lt;span class="fbod quote"&gt; get a look at that cycliophora life cycle. what insanity! where's the individual? these are whole new phyla, on the level of mollusks or segmented worms or arthropods, discovered within the past few decades.&lt;br /&gt;&lt;br /&gt;after reading this article i woke this morning thinking about where these critters fit so i reviewed all these phyla...&lt;br /&gt;&lt;br /&gt;loriciferans, cycliophorans, and micrognathozoa. So i review the phyla: priapulid, kinorhynch, loricifera, nematode, sipuncula, bryozoa, phoronida, brachiopoda, gastrotrich, rotifer, acanthocephala, entoproct, cycliophora, gnathostomulid...&lt;br /&gt;&lt;br /&gt;in my invertebrate biology text.  What chaos of lifestyles and phylogeny.&lt;br /&gt;&lt;br /&gt;well actually the phylogeny is confused! we do not know when the phyla differentiated from each other, nor how long it took? 70million years int the precambrian? 10million years right at the beginning? faster?&lt;br /&gt;&lt;br /&gt;a lot is going on.  many levels of organizition are evolving in parallel with and against each other:&lt;br /&gt;&lt;br /&gt;ecology&lt;br /&gt;organismal anatomy&lt;br /&gt;genes&lt;br /&gt;genetic networks.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;In each clade one can find instances of radical switches in ecology, which select for radical difference in morphology. lineages can go back and forth between these ecological strategies multiple times. see the chart of switches between planktotropy and lecithotrophy in annelid larvae quoted on page 491 of Valentine, from:&lt;br /&gt;&lt;br /&gt;&lt;a href="http://www3.interscience.wiley.com/journal/119052041/abstract?CRETRY=1&amp;amp;SRETRY=0"&gt;Rouse, G. W. 2000. "the epitome of hand waving? Larval feeeding and hypotheses of metazoan phylogeny". Evol. Dev. 2: 222-233 &lt;/a&gt;&lt;br /&gt;&lt;br /&gt;so it is hard to infer phylogeny from looking at aparent homologies in the anatomy/behavior.&lt;br /&gt;&lt;/span&gt;&lt;div id="titleLine"&gt;&lt;br /&gt;&lt;br /&gt;&lt;span&gt;&lt;/span&gt;     &lt;/div&gt;     &lt;span class="fbod quote"&gt;the next level of messiness is in the genetics. the genes and the regulatory circuits guiding development can evolve independantly. the same gene can be coopted again and again for a different developmental task. and we know that genetics can be subject to recombination, so that whole level doesn't form a clean phylogenetic tree...&lt;br /&gt;&lt;br /&gt;&lt;a href="http://blackskimmer.blogspot.com/2007/06/on-evo-devo-and-sean-carrolls-new-book.html"&gt;Sean Carroll on Evo Devo&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;I'm struck by what a rich fragrant MESS evolutionary biology is.&lt;br /&gt;&lt;br /&gt;check out a nice summary in&lt;br /&gt;&lt;br /&gt;&lt;a href="http://books.google.com/books?id=DMBkmHm5fe4C&amp;amp;dq=valentine+phyla&amp;amp;pg=PP1&amp;amp;ots=VPi3_gsdOi&amp;amp;sig=GbQdruccRVFExpV2ag6JNV8QSDI&amp;amp;hl=en&amp;amp;sa=X&amp;amp;oi=book_result&amp;amp;resnum=1&amp;amp;ct=result"&gt; James W. Valentine, "on the origins of phyla"&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;chapter 3 discussing the fragrant chaos of developmental genetic regulatory networks. the book has chaps describing the phyla, the molecular phylogenies, the fossil record and speculations about there mysterious evolution at the end.&lt;br /&gt;&lt;br /&gt;one day i will get to read it.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-4913237604015790646?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/4913237604015790646/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=4913237604015790646' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4913237604015790646'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4913237604015790646'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/08/loricifera-cycliophora-micrognathia-new.html' title='Loricifera, Cycliophora, Micrognathia: New Phyla  Get Me Wondering About Twisty Metazoan Evolution'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-2098188787064992031</id><published>2008-08-12T16:59:00.006-05:00</published><updated>2011-06-18T07:47:09.324-05:00</updated><title type='text'>Is the Evolution of  Complex Eyes an Unlikely Contingent Event  or the Inevitable Consequence of The Axioms Of Physics?</title><content type='html'>I was thinking about the evolution of eyes and such and whether they are odd contingent results of evolution on Earth or whether they are EASY for chemistry and biology to come up with...&lt;br /&gt;&lt;br /&gt;It's a current question in evolutionary theory, for instance:&lt;br /&gt;&lt;br /&gt;If you play the tape over again of evolution wold you get COMPLETELY different weird critters and morphologies as S. J. Gould posited in his &lt;span class="fbod quote"&gt;&lt;a href="http://books.google.com/books?id=SjpSkzjIzfsC&amp;amp;dq=gould+wonderful+life&amp;amp;pg=PP1&amp;amp;ots=2YunXKdqzO&amp;amp;sig=WAuuv-qj66FCgw_qYK23RDREn5M&amp;amp;hl=en&amp;amp;sa=X&amp;amp;oi=book_result&amp;amp;resnum=1&amp;amp;ct=result"&gt;Wonderful Life&lt;/a&gt;&lt;/span&gt;,&lt;br /&gt;&lt;br /&gt;or would evolution converge on many similar structures, as Simon Conway Morris posits in his &lt;span class="fbod quote"&gt;&lt;a href="http://www.amazon.com/gp/product/0521603250/103-2848264-4525407?v=glance&amp;amp;n=283155"&gt;"Life's Solution: Inevitable Humans in a Lonely Universe&lt;/a&gt;" &lt;/span&gt;&lt;br /&gt;&lt;span class="fbod quote"&gt;&lt;br /&gt;&lt;a href="http://pharyngula.org/index/weblog/comments/curse_you_simon_conway_morris/"&gt;Here&lt;/a&gt; we find out that the two are having something of a feud, and Conway Morris is a theist, besides.&lt;br /&gt;&lt;/span&gt;&lt;span class="fbod quote"&gt;&lt;br /&gt;more ideas on this dilemma: &lt;a href="http://www.amazon.com/gp/product/0226476553/103-5776084-6135034?v=glance&amp;amp;n=283155"&gt;Lewin's book "Complexity: Life At The Edge Of Chaos"&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;Take eyes.  are they unexpectedly difficult things to evolve or are they nearly inevitable consequences of the way biology, chemistry and light interacts?  or to take it to the extreme: as Conway Morris posits, is human intelligence ALSO an inevitable consequence of the laws of phyics?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Odd thoughts and the gut response is: of course not!  but then i started thinking of the classification of finite simple groups.&lt;br /&gt;&lt;br /&gt;You set up a simple set of axioms for what constitutes a mathematical group.  then you go exploring the space of all possible groups by messing around, kind of like how evolution explores morphospace, except that we can possibly be more mathematially thorough!  In fact can we find ALL the possible kinds of groups?  is the morphospace infinitely complex, dirt simple or somewhere in between?&lt;br /&gt;&lt;br /&gt;The surprise came a few decades ago when it appeared that we COULD map out all the possible kinds of groups (actually we found all the finite simple groups, kind of like the prime factors of groups)!  And what we found was that there was moderate complexity: 18 different classes, plus...  some chaos:  26 different sporadic groups that did not fall into any of  classes.&lt;br /&gt;&lt;br /&gt;The sporadic groups are odd, HUGE and complex.  the largest has: 808,017,424,794,512,875,886,459,904,961,710,757,005,754,368,000,000,000 elements!&lt;br /&gt;&lt;br /&gt;How on earth did the simple definition of a group imply this interesting space of structures with just a LITTLE bit of chaos?&lt;br /&gt;&lt;br /&gt;Description here (describes axioms for group, some examples you can work out, and pointers to the mathematical results):&lt;br /&gt;&lt;br /&gt;&lt;a href="http://blackskimmer.blogspot.com/2007/03/classification-of-finite-simple-groups.html"&gt;finite simple groups&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;So i'm wondering... if you look at physics, chemistry and the basics of cell bio as the axioms for life, is the possible morphospace a huge infinte chaos, where anything is possible, or is it more manageable with just a little bit of chaos?    And thus, maybe there is not a chaos of sensory organs possible, but a finite bunch of them with eyes, being one of the classes?  Of course the corresponding classification of possible structures must be WAY HUGER than the classification of finite simple groups.  And we also have to model how the historical process of evolution constrained by the specific conditions of a planet (which are in turn modified by the evolution of the organisms...) explores that morphospace!&lt;br /&gt;&lt;br /&gt;Another process that might whittle down the regions of morphospace possible for evolution, is that only a very small fraction of it might be attractive orbits to the evolutionary dynamical system&lt;br /&gt;&lt;br /&gt;Say, as Stuart Kaufmann finds in his &lt;a href="http://blackskimmer.blogspot.com/2008/08/stuart-kaufmanns-random-boolean.html"&gt;random boolean networks&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;So, maybe eyes are not so surprising after all.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-2098188787064992031?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/2098188787064992031/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=2098188787064992031' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2098188787064992031'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/2098188787064992031'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/08/are-eyes-like-monster-finite-simple.html' title='Is the Evolution of  Complex Eyes an Unlikely Contingent Event  or the Inevitable Consequence of The Axioms Of Physics?'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-7041417328981028860</id><published>2008-08-12T16:50:00.001-05:00</published><updated>2008-08-12T16:55:04.599-05:00</updated><title type='text'>Stuart Kaufmann's Random Boolean Networks</title><content type='html'>take N nodes that can be on or off.  hook 'em together into a network with various logical gates coming into each one with an average of k inputs from the others.  look at the ensemble of all such possible systems. &lt;br /&gt;&lt;br /&gt;let each cycle synchronously,  the nodes turning each other on and off.  there ought to be 2^N possible states to such a system.  Kaufmann found that when K is around 2 most of the systems end up falling into one of a MERE sqrt(N) possible attractive cycles!  the systems do not explore anywhere NEAR the 2^N possible states.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-7041417328981028860?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/7041417328981028860/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=7041417328981028860' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7041417328981028860'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7041417328981028860'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/08/stuart-kaufmanns-random-boolean.html' title='Stuart Kaufmann&apos;s Random Boolean Networks'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-295937406880514501</id><published>2008-08-11T14:11:00.001-05:00</published><updated>2008-08-11T14:14:17.959-05:00</updated><title type='text'>Sketch Of How Women Drive The Story In The Bible</title><content type='html'>&lt;span style="font-weight: bold; font-family: verdana;"&gt;women in tora&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;core of stories in the first five books and beyond with very consistent language, style. look at Bloom's "book of J" and Freidman's "hidden book of the bible"&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;nothing voodoo here, just literary analysis.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;In these stories we find the men shirking duty and women taking active role.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;1) adam and eve lounging around the garden, eve gets the whole story rolling by choosing MORE.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;(not sure if this one goes along, but i just thougt of it: twice abraham goes down to some kingdom, egypt, the other one i don't remember, fears the king will kill him for sarah, so she lies for him says she aint married to him and becomes king's consort.  SURE IT DOES, she saves his ass!)&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;2) isaac favors the son that god does not, a son who apparently does not have the right AMBITIONS for the ongoing story, so his wife takes things in hand instructs yaakov what to do and how to trick the father, isaac for the birthright.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;3) are the 12 tribes important to the story? it's yaakov's 4 wives jockying for best position that ends up producing these 12 kids.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;4) judah gets tamar as wife for his first son. the son is not enough for her wild powers of life and dies. the second son, onan, is supposed to take his place, shirks his duty on the ground and is killed for it. judah fears for his third son's life and sends tamar away for awhile. she's tired of waiting, so she takes matters in her own hand, tricks judah into siring kids off her himself.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;the importance of these kids? they lead to David to moshiach by way of Boaz, see Ruth.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;5) lot flees sodom with his two daughters. as far as the DAUGHTERS know, huddled in the cave having seen their whole world destroyed, they are IT, so they trick him into having kids. One kid is.. MOAB. significance? see Ruth.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;6)Moses tries to shirk his calling 5 times before grudgingly accepting. then on the way back to egypt he tries to shirk again, asking god to kill him rather than make him a prophet ( a VERY tough calling, common for prophets to wish death instead) but his wife zipora says "oh know you don't you have a duty to me your wife, to your son to enter into the covenant of jews, to your people! she saves him with a ritual circumsision.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt; 7) finally, Ruth:  Naomi is Boaz' relative, she and her two sons and husband move to MOAB, where her sons die and leave no kids. one of their wives is Ruth who loves Naomi and the jews, the STORY so much, she asks to come back to israel with her. there, Boaz is the nearest relative and his responsibility is to give Ruth kids, but he isn't interested. Naomi and Ruth seduce him into it. Ruth is of MOAB, lot's daughters' decendants.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;she has a kid. this joins two ancient antagonistic people into the line that will lead though david to the moshiach bringer of world peace.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;Just What is the story that this extended J tradition is trying to teach?  something about preservation of this grand story by acts of women?  must read Bloom again for some clues.&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight: bold; font-family: verdana;"&gt;Side note on christianity.  everybody wants to enter this grand jewish STORY, so the christians try to adopted themselves into it FORCEFULLY.  Mary takes god into her, but it's not in David's line, only her husband is, so where from Jesus?  odd.  the new testament certainly does NOT continue in this 'book of J' literary tradition!  It's way too abstract!&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-295937406880514501?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/295937406880514501/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=295937406880514501' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/295937406880514501'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/295937406880514501'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/08/sketch-of-how-women-drive-story-in.html' title='Sketch Of How Women Drive The Story In The Bible'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-5914433849610067958</id><published>2008-07-24T11:32:00.003-05:00</published><updated>2008-08-12T18:19:43.932-05:00</updated><title type='text'>Changes In Fetal Circulation At Birth</title><content type='html'>&lt;a onblur="try {parent.deselectBloggerImageGracefully();} catch(e) {}" href="http://a248.e.akamai.net/7/248/430/20080327144026/www.mercksource.com/ppdocs/us/common/dorlands/dorland/images/circulation_fetal%20c.%281%29.jpg"&gt;&lt;img style="margin: 0pt 0pt 10px 10px; float: right; cursor: pointer; width: 400px;" src="http://a248.e.akamai.net/7/248/430/20080327144026/www.mercksource.com/ppdocs/us/common/dorlands/dorland/images/circulation_fetal%20c.%281%29.jpg" alt="" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;the other day i mentioned that there was a muscle in the newborn infant that closes like a fist around the umbilical artery at birth.  I thought i read this somewhere and tried later to find it.  I couldn't find where i read it but i did find my physiology text and it describes fetal circulation pre and post birth.&lt;br /&gt;&lt;br /&gt;the story, as usual, is a lot more complicated and subtle.  there are half a dozen places where fetal circulation has to be rerouted, and of course blood vessels all have smooth muscle walls already, so these are the muscles responsible for closing things off.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;FETAL CIRCULATION, DIFFERENCES&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;main points:&lt;br /&gt;&lt;br /&gt;the lungs in the fetus do not function, so no need for blood to flow in and out of them.&lt;br /&gt;&lt;br /&gt;The mother's liver takes on most of the liver function so not much blood needs to pass through the fetal liver either.  (note that SOME blood passes through the usual routes in the liver and lungs and no doubt this flow of blood mechanically and chemically is necessary to modulate the development of those organs.)&lt;br /&gt;&lt;br /&gt;i don't see any info on fetal kidneys.  do they function?  I imagine the mother's kidney's function for the fetus?  where would fetal urine go?  i see a tube called allantois coming out of the urinary bladder going into the umbilical cord, makes no sense?&lt;br /&gt;&lt;br /&gt;fetal blood flows from internal iliac artery to umbilical arteries to the placenta.  the blood which has been enriched in nutrients and oxygen and has been cleansed of wastes and CO2 flows back in the umbilical vein.  some goes to the fetal liver, through the liver into the inferior vena cava.  the rest goes through a bypass called the ductus venosus around the liver into the inferior vena cava.  the veins from the intestines which WILL send nutrients to the body through the liver also connect to this bypass.&lt;br /&gt;&lt;br /&gt;from there to the right atrium.  from the right atrium it has 3 choices:&lt;br /&gt;&lt;br /&gt;1) the usuall route into the right ventricle and to the lungs.  the fetal lungs are collapsed and not much blood takes that route.&lt;br /&gt;&lt;br /&gt;2) a shunt to the aorta called the ductus arteriosus.&lt;br /&gt;&lt;br /&gt;3) flow to the left atrium via a flap covered opening, the foramen ovale in the interatrial septum.&lt;br /&gt;&lt;br /&gt;most of the highly oxygenated blood from the placenta flows across to the foramen ovale into the left atrium and to the aortic arch.  this supplies the brain which is the organ in the fetus that needs the most oxygen.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;CHANGES AT BIRTH:&lt;br /&gt;separation from the placenta causes oxygen to drop and carbon dioxide to build up.  this induces the infant to take its first breath. expansion of the lungs allows blood to flow from the right ventrical to the pulmonary arteries.  blood is now returning from the lungs to the left atrium and increases pressure there.  this causes the flap of the foramen ovale to close.  thus the blood from the right atrium now has only two choices.  (eventually the foramen ovalle is closed with connective tissue.&lt;br /&gt;&lt;br /&gt;increased pressure in the left side of the heart and reduced pressure in the right side mean more pressure in the aorta and less coming from the right ventrical to the ductus arteriosis into the aorta.   the ductus arteriosis now constricts.  It's got smooth muscle around it right?  WHAT IS THE SIGNAL to constrict?  within weeks it is obliterated by fibrous connective tissue.&lt;br /&gt;&lt;br /&gt;my text doesn't mention any particular constricting on the part of the umbilical arteries, just that they fill in.  curious.  i don't see why there would be any less blood pressure in them after birth, they come off the bottom of the aorta, internal iliac artery.&lt;br /&gt;&lt;br /&gt;ditto the umbilical vein gradually fills with connective tissue.&lt;br /&gt;&lt;br /&gt;the text does mention that the ductus venosus (from umbilical vein to vena cava) does constrict.   This causes the blood from the infant's intestines to flow into the hepatic portal vein into the liver.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="www.mercksource.com/ppdocs/us/common/dorlands/dorland/images/circulation_fetal%20c.%281%29.jpg"&gt;diagram from here&lt;/a&gt;&lt;br /&gt;&lt;pre id="line1"&gt;&lt;br /&gt;&lt;/pre&gt;the anatomy from:&lt;br /&gt;"Human anatomy and physiology" 2nd ed.  Alexander P. Spence and Elliott B. Mason.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-5914433849610067958?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/5914433849610067958/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=5914433849610067958' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5914433849610067958'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/5914433849610067958'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/07/changes-in-fetal-circulation-at-birth.html' title='Changes In Fetal Circulation At Birth'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-4377730397817771523</id><published>2008-06-19T14:15:00.001-05:00</published><updated>2008-06-19T14:21:14.212-05:00</updated><title type='text'>Notes On the Species Problem From Futuyma</title><content type='html'>(Futuyma pg 448)&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Early taxonomists (predarwin) held what Ernst Mayr has called a "typological" or "essentialist" notion of species.  Individuals were members of a given species if they sufficiently conformed to that "type" or ideal, in certain characters that were "essential", fixed properties, a concept descended fom Plato's "ideas".&lt;br /&gt;&lt;br /&gt;Nevertheless populations ARE variable.  Quite often the variation among specimens falls into discrete groups, or clusters, as in the case of the raven versus crow.  These clusters, for early taxonomists, were species.  Each had certain "essential" defining properies, such as the ravens's pointed tail, that varied only slightly.  But often gradations between such clusters DID exist.  For instance , carrion crows whcih are entirely black, differ from hooded crows which have a gary back and belly, EXCEPT in certain parts of Europe, where some specimens ARE intermediate.&lt;br /&gt;&lt;br /&gt;the existence of such cases has led some authors to conclude that species are arbitrary constructs of the human mind imposed on a a continuuum of variation.  Darwin for one, took this position.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;There coexisted, even in the eighteenth century, another criterion: common descent.  Offspring of the same parents were the same species, EVEN if they differed considerably (from each other or the parents). [this is important, and leads to subtle points].. the striped and banded forms of the California king snake known to be born to the same mother, represent a genetic polymorphism, not different species.&lt;br /&gt;&lt;br /&gt;By the early 20th cent.. Mayr, in his Systematics and the Origin of Species (1942) noted:&lt;br /&gt;&lt;br /&gt;1) many, perhaps most, characteristics vary among the members of a single population of interbreeding individuals.  Sometimes continuus quantitative variation; sometimes discrete like the king snake.&lt;br /&gt;&lt;br /&gt;2) populations in different geographic locations usually differ in the mean of one or more characteristics.  very often intermediate forms are found where such populations meet, providing evidence [?] that they interbreed.&lt;br /&gt;&lt;br /&gt;3) what APPEARS at first to be a single, MORPHOLOGICALLY uniform species often proves to include two or more subpopulations that occupy the same area, but do not interbreed.  these cryptic sibling species might be recognized on the basis of some form of reproductive barrier (different genetalia, different breeding seasons, etc..)  for instance two treecreepers (birds) in central europe almost identical but for very different songs.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;the abundance of variation within and between COMBINED with Darwin's view that all characters can keep evolving into more and more different characters led to the abandonment of the typological species concept.  the biological species concept became more and more widely held.  promulgated by the likes of Dobzhansky (1937) and Mayr (1942).  Mayr defined it: "species are groups of actually or POTENTIALLY interbreeding poplations whcih are reproductively isolated from other such groups"&lt;br /&gt;&lt;br /&gt;It has some drawbacks. &lt;br /&gt;&lt;br /&gt;1) it only works in a particular slice of time.  if you look at a branching lieage over time.. you can't test whether the population at time A could interbreed with the population at time B.  these may be seperated into what are called chronospecies. &lt;br /&gt;&lt;br /&gt;2) if a lineage forks, we do not know which fork...  is it one lineage with a side lineage or is it 3 chronospecies...&lt;br /&gt;&lt;br /&gt;3) of course it doesn't work for asexual populations&lt;br /&gt;&lt;br /&gt;4) this is a definition in terms of populations, not individuals.  chihuahuas don't (i don't think) mate with great danes, but in a population of dogs, chihuahuas can mate with dachshunds, which mate with i don't know my dogs! which mate with ... which mate with great danes.  this last point opens up the whole can of worms!  for instance Ring Species:&lt;br /&gt;&lt;br /&gt;http://www.actionbioscience.org/evolution/irwin.html&lt;br /&gt;Ring Species: Unusual Demonstrations of Speciation&lt;br /&gt;By Darren E. Irwin&lt;br /&gt;&lt;br /&gt;[blending!  till they meet  at the begining again.  so all it takes is ....  extinction in the middle!]&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;5) the definition of reproductive isolation is "those which are naturaly [?] reproductively isolated from each other by their own behavior"  which is WHAT?  their behavior depends on the environment no?  so as individuals migrate to different environments what might happen?  anyway there are plenty of populations who DON'T mate in their usual habitat who CAN be induced to mate in artificial environments and who's offspring is fertile.&lt;br /&gt;&lt;br /&gt;these last two lead us to an important fact.  many seemingly fixed boundaries CAN leak occasionaly  either through modification of behavior (by environment or by mutation) or through slow leakage through roundabout intermediates (like the chihuahua and great dane, or like ring species.&lt;br /&gt;&lt;br /&gt;6) many populations are geographically isolated and will never manage to interbreed even though if we brought individals from them together they WOULD.  hmm what to say?  this is like (5)!!!  BSC says they are both part of the same species.  but frankly i think that stinks of essentialism!  the fact is that species maybe is a property of the whole biome not just property of the organisms's essence!  hence i say if we are not to be essentialists we call those two different species.  the environment is part of what defines the species.  and certainly with time the two populations might diverge reproductively anyway.&lt;br /&gt;&lt;br /&gt;hell, the fact is that species might be nothing at all!&lt;br /&gt;&lt;br /&gt;Futuyma (pg 452) says it would be absurd to call every geographicaly isolated pocket of frogs a different species.  this is similar to the problem with dandelions.  who at some point in the past were sexual, but now have given it up and have split into thousands of pockets of nonbreeding slightly different populations.  of course frogs occasionaly travel (by flood maybe) and these dandelions OCCASIONALY have sex...&lt;br /&gt;&lt;br /&gt;LEAKS!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Baum and Shaw's genealogical species concept adds to this idea of leaks.  (p452)&lt;br /&gt;&lt;br /&gt;one thing we gotta mention now is that organisms are mosaics.  genetically we are mosaics of thousands of discrete (almost, everything has messy exceptions) genes each in pairs, one from each parent.  for each gene position on the chormosomes, in the population there might be many versions, in fact since we are diploid, even an individual organism can have two versions of a gene, one from each parent. these versions are called alleles.  the gene is called a locus.&lt;br /&gt;&lt;br /&gt;(of course it's very messy, not only can genes get mutations so that one of an offspring's allele can differ from its parent, you can have all kinds of mutations.  for instance a gene can get duplicated!  now where a parent has one gene called A332, the offspring has two of them from one parent and one from the other.  in time this gets passed down and one of the copies can get a mutation and now some members of the population can have A332 and A332...)&lt;br /&gt;&lt;br /&gt;the point is, that two subpopulations can be similar for SOME genes and different for OTHERS!  each gene can evolve INDEPENDANTLY to varying extents.&lt;br /&gt;&lt;br /&gt;so, genealogical species concept: after a population splits in two, each half has a mix of these different alleles for each gene.  now whether alleles make it to the next generation is a chancy event, or it might be selected for.  so eventually for gene 12444 a member of pop A might have alleles similar to pop B, while for gene 24432 a member of pop A will have alleles similar to pop A.  so which genes do we look at to tell whether these two populations are distinct species or not?&lt;br /&gt;&lt;br /&gt;this by the way is the case for ALL human populations.  can't tell if there are distinct races for ALL genes.  we all split up TOO recently, and still too much MIXING.&lt;br /&gt;&lt;br /&gt;the genealogical species concept is we wait till the populations keep going until enough alleles get lost through randomly not breeding into the next generation so that pop A has only alleles in common with it for ALL (or MOST?) genes and pop B has alleles in common with it.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;more problems with BSC:&lt;br /&gt;1) narrow hybrid zones.  there are cases where what looks like different species meet at a border and for a narrow zone at that border  you find hybrids.  there is evidence of pairs like this existing for some time, yet remaining distinct.  some kind of mechanism is allowing SOME hybridization to take place, but the hybrids are not as fit as the parent species and the zone of hybridization doesn't spread through the seperate populations.  this does NOT mean that individual genes, cant travel from one population to the other!  the overall mix in the hybrid might be rather unfit, but single genes from populoation A might still eventually spread throughout population B.  LEAKS!&lt;br /&gt;&lt;br /&gt;2) this can even happen with two populations sharing the same teritory.  just that hybrids are VERY RARE. &lt;br /&gt;&lt;br /&gt;the question is what mechanism maintains this!&lt;br /&gt;&lt;br /&gt;plants however work different than animals.  and in fact the BSC may not be as useful for plants as animals.  for instance there are many plant groups that rampantly hybridize all over the place like Quercus (oaks) and even worse: Crataegus (hawthorns)&lt;br /&gt;&lt;br /&gt;so here is the point  since different genes can have different propensity to spread from one population to another... some genes might affect something minor like color.  some genes might affect something major like adaption to new niches.  and some genes might affect MATING BEHAVIOR.&lt;br /&gt;&lt;br /&gt;and now we have to talk about reproductive isolation.&lt;br /&gt;&lt;br /&gt;what are the things that can cause this:&lt;br /&gt;&lt;br /&gt;1) geographical isolation&lt;br /&gt;&lt;br /&gt;2) behavioral difference: what time of day to mate, on which plant to mate, which way to dance, which color plumage you like, what kind of song you learn...&lt;br /&gt;&lt;br /&gt;3) anatomical diff: maybe your penis is shaped the wrong way..&lt;br /&gt;&lt;br /&gt;4) biochemical mechanisms that block  the viability of sperm or pollen&lt;br /&gt;&lt;br /&gt;5) difference in genetics (chromosomes ) that make the zygote unable to form&lt;br /&gt;&lt;br /&gt;6) differnece in genes that make development botch up somehwere down the road&lt;br /&gt;&lt;br /&gt;7) differences in genetics that make the offspring unable to perform mieosis and thus make viable eggs or sperm and thus GRANDCHILDREN are impossible.&lt;br /&gt;&lt;br /&gt;biology is fun, no?&lt;br /&gt;&lt;br /&gt;each of these mechanisms CAN be the product of a single mutation so potentially this can happen in one generation.  for instance in plants, it is common that an offspring gets the wrong number of chromosomes (double or 2/3 etc..) and can only therefore mate with another offspring with the same mutation.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;What's the upshot?  the dicotomy is: are species a property of the whole history of the whole population structure or is species a property of some innate properties of individual organisms?&lt;br /&gt;&lt;br /&gt;the Eldredge and Gould claim that a large part of the fossil record consists of: for layer after layer fossils of a certain type wander around a mean of morphology for a coupla million years and then switch to a nother mean quickly (in geological time) and then stay wandering around the new mean.  (punctuated equilibrium)  or the type splits into a FEW distinct types which each then wander around their distinct means...&lt;br /&gt;&lt;br /&gt;there are two poles and probably everything inbetween:&lt;br /&gt;&lt;br /&gt;1) individuals reproduce to randomly varying offspring and the set of individuals wander higgledy piggledy all over the space of all possible varieties. but since each niche has finite carrying capacity there is arbitrary extinction.  therefore after awhile gaps appear between lineages.  i don't know how much natural selection is needed for this to happen.&lt;br /&gt;&lt;br /&gt;2) the logic of development, physiology, ecology act as feedback loops which encourage mutations of only certain types to persist and rejects other mutations, until a combination of mutations creep in that throws the system into a new set of feedback loops keeping the system around a new norm (which would give punctuated equilibrium)   This would correspond to typological species concept.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-4377730397817771523?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/4377730397817771523/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=4377730397817771523' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4377730397817771523'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4377730397817771523'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/06/notes-on-species-problem-from-futuyma.html' title='Notes On the Species Problem From Futuyma'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-7633244164401860809</id><published>2008-06-01T09:09:00.002-05:00</published><updated>2008-06-01T09:11:56.929-05:00</updated><title type='text'>On Discovering The Chemical Origins Of Life: Dissecting Nanofilm Fossils Of Chemical Reactions!</title><content type='html'>At some stage in Geochemistry chemical reactions acccumulate heredity!  Somehow the catalaysts have to couple their existence to their product!  So if there is a catalyst that produces some organic compound that HELPS BRING MORE OF THAT CATALYST TO THE REACTION SITE then that catalyzed reaction will explode!&lt;br /&gt;&lt;br /&gt;In a sense it's not a matter of the improbability of life but the fact that since the ULTIMATE product, life, is so much better at capturing the most common form of energy flow around, sunlight, then those reactions that moved TOWARDS life would have outcompeted the millions of other possibilities!  Is this RIGHT?  It's teleological after all?  Is the origin of life simply an optimization problem solved by simulated annealing?&lt;br /&gt;&lt;br /&gt;So for the origin of life we got to search for the reactions where metal ions will catalyze a reaction that produces a product that helps bring that ion into the reaction arena, or that uses up a reactant that keeps that ion from coming into the reaction arena.  Or teams of reactions that help each other out... &lt;br /&gt;&lt;br /&gt;Are there any FOSSILS of this era left?  hmm... either embedded in current biochemistry, OR in the rocks. &lt;br /&gt;&lt;br /&gt;So all sorts of geochemistry was happening.  We have to search the rocks that are left from 4.5billion years ago to 3.6billion years ago and analyse each one for HOW IT FORMED.  We have to find the ones of sedimentary origin and reconstruct the chemical reactions and their environment that produced them.  We might be talking ULTRAMINUTE geochemical fossils!  What could POSSIBLY be their chances of having survived to the present????  What we are looking for is the result of some of these geochemical reactions that gets buried beyond reach before the new round of reactions got to the results to rework them!&lt;br /&gt;&lt;br /&gt;Could it all be possible; (A) that enough of these has survived?  (B) that we can FIND them, they might be widely scattered thin films smaller than bacteria! (C) reconstruct what happened! &lt;br /&gt;&lt;br /&gt;Well, science has become a 400 year tradition of ULTRAMASTER CRAFTSPEOPLE with very sophisticated instruments!  We'd have to dissect ancient strata atom by atom, perhaps!  We'd have to do a LOT of simulations!  We'd have to explore ALL MANNER of combinations of crazy reactions between organic compounds and minerals in all kinds of conditions!  It'd be a LOT of work.  Is it Worth it?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Knowing how life is a natural consequence of the chemistry we can see, play with today?  that the universe is so stable that it worked 4billion years ago with the same laws as it works today?  That we ARE PART OF this universe and in reconstructing the creation that happened 4billion years ago, we have hope of BECOMING PART OF THE NEXT 4 BILLION YEARS OF THIS CREATIVE UNIVERSE STORY?&lt;br /&gt;&lt;br /&gt;God!  in order to accomplish that promise, we'd have to become wise.  Or clever.  Well, either way it means, if we want to survive that long, learn to explore new niches and cooperate!  That means GET OFF THIS PLANET! &lt;br /&gt;&lt;br /&gt;To explore new niches means colonize other places outside this Earth and get away from each other for awhile, then cooperate with each other's colonies.  That's the way it always is! &lt;br /&gt;&lt;br /&gt;I imagined this scenario in high school:  If humanity is to survive, we have to get off this planet, get into a historic cycle of hopping from planet to planet, where each time we get to a new planet, our technology is basically lost, start from scratch, but we retain history of our social arrangements and as technology keeps resetting, our social wisdom steadily grows over 10s of thousands of years...  hmm... not bad. &lt;br /&gt;&lt;br /&gt;Just as some clever reaction cycles ultimately covered every niche on this 16million square miles of Earth, life can eventually cover the universe?&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;more on Homo sapiens learning to master the universe:&lt;br /&gt;&lt;br /&gt;http://blackskimmer.blogspot.com/2008/06/social-insects-created-amazing-tropical.html&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-7633244164401860809?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/7633244164401860809/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=7633244164401860809' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7633244164401860809'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/7633244164401860809'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/06/on-discovering-chemical-origins-of-life.html' title='On Discovering The Chemical Origins Of Life: Dissecting Nanofilm Fossils Of Chemical Reactions!'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-4756222699160428768</id><published>2008-06-01T08:37:00.002-05:00</published><updated>2008-06-01T08:49:34.568-05:00</updated><title type='text'>The Social Insects Created The Amazing Tropical Forests Of This Earth, How Can We Match Their Feat?</title><content type='html'>Some sunday morning musings on cooperation vs competition in evolution and human history:&lt;br /&gt;&lt;br /&gt;The popular idea has always been that it's a jungle out there, red in tooth and claw, survival of the fittest and all that.  And of course Humans have always heaped glory upon their warriors for entering that fray!&lt;br /&gt;&lt;br /&gt;But the fact of the matter is that the more time you spend cometing with your neighbors the LESS time you are spending RAISING KIDS.  RAISING KIDS is what evolution is about, not competing.  So there are two strategies that life has come up with for spending less time competing so it can raise kids:&lt;br /&gt;&lt;br /&gt;1) divide up the environment by exploring niche space and diversifying. if i stick to hunting rabbits and you stick to collecting nuts, we don't have to compete!&lt;br /&gt;&lt;br /&gt;2) cooperating!  I'm very fond of the social insects, and the reason why the ants rule the tropics is because they cooperate!  I know that Honeybees for instance have AMAZINGLY low infant mortality in their hives, compare that to the mass of insects that lay 100s of eggs to have maybe 1 survive to adulthood! Ants take care of the place, they recycle all the materials, they spread out the trees and keep species diversity high, in fact there are over 8,000 different species of ants, they keep their OWN diversity high!  And with the trees spread out so far, it takes the social stingless bees to pollinate them, making trips miles long just to pollinate a single species of tree when it blooms.&lt;br /&gt;&lt;br /&gt;then i got to wondering about the chemical origins of life, and our next 4billion years of history ahead of us co-creating the universe.  I thought up a scenario where we could possibly find ancient chemical fossils of the origins of life and learn how it happens, maybe learn to do it ourselves.  But it would take a LOT of work.  Do we have the TIME to accomplish the task?  Can we avoid a really DIRTY world war III?  How can we slowly mature and explore the potentials of Homo sapiens?&lt;br /&gt;&lt;br /&gt;How does cooperation or niche exploration vs competition relate to our current dilema?  Well, Homo sapiens IS the cooperating critter PAR EXCELENCE!  that's why we are coming to rule the whole planet just as the ants rule the tropics!  unfortunately whereas the ants probably took 10s of millions of years to learn the art of ecosystem governance, We tried to accomplish the feat a TAD too quickly: 100,000 years maybe?  10,000 years?  We are not doing so well at it!  While the ants and bees have built up amzingly diverse tropical forest over the past 10s of millions of years, we are taking them down in a mere coupla thousand!&lt;br /&gt;&lt;br /&gt;Some ants even form supercolonies!  (But so far I know of NO examples of TWO DIFFERENT species of ants COOPERATING!  That's odd.  There certainly are plenty of symbioses out there between other species.  I even recall that there are two different species of Rock Hyraxes that nest together and raise each other's kids!  (odd story, needs to be looked into!) )&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Though we liberals are resisting this Global economy kicking and screaming, perhaps ultimately (after ironing things out and surely along the way MANY disenfrachised will suffer) it will provide a mechanism for cooperation between major ideological groups of us now currently fighting?&lt;br /&gt;&lt;br /&gt;I don't know.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;The other option is niche diversifcation.  The Earth is pretty full, we are all crammed up against each other, there is no room to experiment with new languages, new cultures, new forms of government...No room to start out from scratch!  The last such experiments where in australia and north america, and those have pretty much played out!  We NEED MORE ROOM!  Think of what a VAST PLAYGROUND this earth was for those tiny simple ants to explore!  But we humans are VAST creatures.  First of all we are BIG.  Second of all we tend to coagulate into colonies of 100s of millions, covering an ENTIRE CONTINENT, that's INSANELY BIG, few species of ants come close to matching that!  But mostly OUR MINDS are vast.  An individual can imagine whole ecosystems in there!  We can imagine mastering the cosmos itself.  We need a larger arena to grow up in!&lt;br /&gt;&lt;br /&gt;Well,  there is a lot of real estate out there in the cosmos!  Science is nice, technology is nice, but what we need is some WISDOM in how to be human beings!  We need more TIME AND ROOM to do experiments in human civilization!&lt;br /&gt;&lt;br /&gt;In high school i imagined the following scenario:  If we were to send a ship of colonists out to colonize another planet, think of what they are starting from: scratch!  Perhaps like ants sending their mated queens into the wind hither and thither, 100s of colonist ships spreading randomly out there exploring.  maybe a few find some habitable planets in a coupla hundred years, and when they land?  i tried to imagine what it would take to reproduce our massive network of industrial/technological abilities that we take for granted!&lt;br /&gt;&lt;br /&gt;forgedaboutit!  they are gonna be struggling to grow crops, build shelter, have kids and survive!  What i hope is that we can set up a new cycle:  reset our technological level to almost zero every coupla hundred years as we hop to the next planet, but retain the knowlege, the history of our sociology, psychology, educational and governing methods.  By resetting the technology each time we will allow the experimenting in social interactions to go on slowly. And continuing to spread out the human experiment, will give us some space from each other, a chance to get our bearings and then have new rounds of economic and cultural interactions on vaster scales!&lt;br /&gt;&lt;br /&gt; I think we can slowly explore the human potential!  And that potential is VAST.  Just as some some tiny colonies of simple bacteria, each a ten thousandth of an inch wide,  4billion years ago have come to spread across the 16million square miles of Earth and RESHAPE it,  I can fully imagine us becoming gods, learning to master the foundations of the cosmos and reacreating new universes!&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-4756222699160428768?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/4756222699160428768/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=4756222699160428768' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4756222699160428768'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/4756222699160428768'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/06/social-insects-created-amazing-tropical.html' title='The Social Insects Created The Amazing Tropical Forests Of This Earth, How Can We Match Their Feat?'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-3424945357471201214</id><published>2008-05-30T12:09:00.000-05:00</published><updated>2008-05-30T12:11:05.570-05:00</updated><title type='text'>I Plucked a Cell of Me and Filled it With Yolk</title><content type='html'>well,&lt;br /&gt;I plucked a cell of me and filled it with yolk. &lt;br /&gt;and folded in memories of my mother and father.&lt;br /&gt;&lt;br /&gt;and i chose me a man to strip myself bare with. &lt;br /&gt;and i chose him to become a suckling child with. &lt;br /&gt;i chose me a man to become sweaty with&lt;br /&gt;a man to incite my egg to grow.&lt;br /&gt;and i became slimy inside, and he put himself in me&lt;br /&gt;and we set to scratching our itches to swells of excitement&lt;br /&gt;to set the passage ways squirting and yearning&lt;br /&gt;and he thundershowered millions of raindrops into me&lt;br /&gt;swimming little critters of himself into me,&lt;br /&gt;mixed memories of his fathers and mothers into me&lt;br /&gt;and I rippled with pleasure calling them deeper&lt;br /&gt;to join with myself, my eggself if they could. &lt;br /&gt;and they raced with each other and they with fought each other&lt;br /&gt;and they swam for a day&lt;br /&gt;till they landed on the yolky shore of my eggself&lt;br /&gt;and she chose only one and she ate him&lt;br /&gt;and they joined themselves to be you. &lt;br /&gt;&lt;br /&gt;and all his other selves died, and i expelled them.&lt;br /&gt;&lt;br /&gt;and you, the lucky one, &lt;br /&gt;started out like a mushroom,&lt;br /&gt;then you swelled to a jelly fish&lt;br /&gt;then you folded into a worm and you almost died,&lt;br /&gt;as your brother did when he folded the wrong way, and i expelled him.&lt;br /&gt;&lt;br /&gt;but you rippled into a fish finally&lt;br /&gt;swimming in my watery womb&lt;br /&gt;behind my belly button memory of my mother. &lt;br /&gt;&lt;br /&gt;but you weren't really a fish,&lt;br /&gt;your gills didn't work to breath in my waters&lt;br /&gt;couldn't breath the oxygen dissolved in my waters,&lt;br /&gt;there was no krill in my wombsea to eat&lt;br /&gt;so i wove myself to you again&lt;br /&gt;and i bled into you and you bled into me.  and you almost killed me. &lt;br /&gt;&lt;br /&gt;then you became a newt. &lt;br /&gt;then you became a mouse. &lt;br /&gt;then you became a scratching kicking puppy and it was time to let you out. &lt;br /&gt;&lt;br /&gt;so i pushed and you held on&lt;br /&gt;and i pushed harder and you screamed silently kicking&lt;br /&gt;and i pushed and i dumped out my wombwaters leaving you soggy,&lt;br /&gt;and i screamed&lt;br /&gt;and it was hell,&lt;br /&gt;an all night wrestling match,&lt;br /&gt;and i might have hated you for a moment or two&lt;br /&gt;till i finally tore you from me bleeding placenta&lt;br /&gt;and pushed you into the world all bloody and slimy, and i almost died again.&lt;br /&gt;&lt;br /&gt;and our shared arteries were severed&lt;br /&gt;and your muscles thought fast&lt;br /&gt;and closed like fists around them forever&lt;br /&gt;separating our bloodtides lest you bled to death&lt;br /&gt;and  your eyes blinked in the light for the first time&lt;br /&gt;and you felt the cold dry air for the first time&lt;br /&gt;and you had to cough the warm womb water from your lungs&lt;br /&gt;to breath in the fiery oxygen for the first time&lt;br /&gt;and you yelled your lungs into breath. &lt;br /&gt;and i fainted. &lt;br /&gt;and you woke up to your own long frightening  journey.&lt;br /&gt;&lt;br /&gt;and i grew great sweat pimples from my chest into breasts&lt;br /&gt;and filled them with milk from my fat&lt;br /&gt;and you swam, a fish again, on my belly&lt;br /&gt;and you sucked my milky waters and i warmed you.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;we tried to stay together, you,&lt;br /&gt;my fish swimming in my breasty sea,&lt;br /&gt;but dammit you kept growing.&lt;br /&gt;&lt;br /&gt;first you were a fish,&lt;br /&gt;then you were a larva with giant oggling laughing head,&lt;br /&gt;then your eyes focussed, &lt;br /&gt;then your hands grasped,&lt;br /&gt;then you learned to eat&lt;br /&gt;and my seeping springs of milk ran dry.&lt;br /&gt;&lt;br /&gt;then your fingers became intelligent. &lt;br /&gt;then you got on your feet and walked from me to explore the world. &lt;br /&gt;and you imagined yourself into a separate being and feared the night. &lt;br /&gt;&lt;br /&gt;and that's where you came from&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4971718010905276598-3424945357471201214?l=blackskimmer.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://blackskimmer.blogspot.com/feeds/3424945357471201214/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=4971718010905276598&amp;postID=3424945357471201214' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3424945357471201214'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4971718010905276598/posts/default/3424945357471201214'/><link rel='alternate' type='text/html' href='http://blackskimmer.blogspot.com/2008/05/i-plucked-cell-of-me-and-filled-it-with.html' title='I Plucked a Cell of Me and Filled it With Yolk'/><author><name>barry goldman</name><uri>http://www.blogger.com/profile/16743805553714198251</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-4971718010905276598.post-4882192631628430326</id><published>2008-05-21T11:36:00.005-05:00</published><updated>2008-05-21T15:30:02.074-05:00</updated><title type='text'>Khoshekayim v'khoshekhim: Primordial Darkness vs. Curtain Darkness</title><content type='html'>this is my ongoing notes on a discussion of yhvh talking from light and darkness in deutoronomy 5:19 to 23&lt;br /&gt;&lt;br /&gt;moshe is recounting the scene at sh'mot 19, so we need to go BACK.&lt;br /&gt;&lt;br /&gt;let's go to the beginning:&lt;br /&gt;&lt;br /&gt;sh'mot 3:2&lt;br /&gt;v'yera mal'akh %&amp;amp;$** 'alaiv b'labat 'esh mitokh has'neh.  v'yar' v'heneh has'neh bo'er b'esh v'has'neh 'einenu 'ukhal.&lt;br /&gt;&lt;br /&gt;v'yomer moshe 'asura na v'er'eh 'et hamar'eh hagadol haze, madua' lo yiv'ar has'neh.&lt;br /&gt;&lt;br /&gt;v'yar' &amp;amp;*%$$^&amp;amp; ki sar lir'ot.  vyikra' eleiv 'elohim mitokh has'neh, v'yomer moshe moshe, v'yomer hineni.&lt;br /&gt;&lt;br /&gt;ok this is where it starts.  how does *%%^&amp;amp; call?  by peaking someone's curiousity.  *^%%$ did not bludgeon moshe over the head, in fact you cant SEE a flame in broad dayligh!  you can only see it in the contrasting darkness inside a bush!  and even then, it is not obvious and &amp;amp;%$&amp;amp;% is pleased that moshe was WATCHFUL and CURIOUS!&lt;br /&gt;&lt;br /&gt;so this flame in the darkness of a s'neh!  That's the prefered mode of mal'akhei &amp;amp;%%^&amp;amp;  fireflies in the night.&lt;br /&gt;&lt;br /&gt;s'neh and sar (to turn) both with samekh.&lt;br /&gt;&lt;br /&gt;a bush which is burning but is not consumed.  this is an image for something.  the heart?  the jewish people?  a coal?  looking into burning coals is a confusing thing, various levels of contrast between light and darkness&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;now  13: 21 v#$#@ holekh liphneihem yomam b'amud 'anan (both ayin column of cloud) lankhotam haderekh, vlayla b'amud 'esh l'hair l'hem.&lt;br /&gt;&lt;br /&gt;13:22 lo yamish 'amud he'anan .. liphney ha'am.&lt;br /&gt;&lt;br /&gt;ok, they have &amp;amp;&amp;amp;*%%$ in a cloud (darkness?) by day and *&amp;amp;$$# in a fire (light) by night.  $#$$@ is a pillar, a beacon, and it's primary property is contrast, to show the way.  no araphel yet.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;next installment, the scene at the split sea, HEAVY!&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;oh right here spelled out:&lt;br /&gt;&lt;br /&gt;14:20  the 'amud moves behind the camp of yisrael to protect from the chasing egyptians:&lt;br /&gt;&lt;br /&gt;v'yavo bein makhaneh mitzrayim 'uvein makhaneh yisro'el v'y'hi he'anan v'hakhoshekh v'y'ir 'et halayla v'lo karav ze 'el ze kol halayla&lt;br /&gt;&lt;br /&gt;what it looks like depends on who's looking at it.&lt;br /&gt;&lt;br /&gt;whoah!  this is a heavy scene!  the jews are encamped against the sea.  they sea the egyptians coming at them.  the pillar starts out as a cloud but then the text says night, night is falling.  for the egyptians it remains a cloud of darkness, for the jews it becomes a pillar of light lighting the night.  yhvh says to moshe, don't just stand there!  split the seas!  this is 
